Báo cáo khoa học: Characterization of inhibitors of phosphodiesterase 1C on a human cellular system potx

... Authors Journal compilation ª 2007 FEBS Characterization of inhibitors of PDE1C T. R. Dunkern and A. Hatzelmann Characterization of inhibitors of phosphodiesterase 1C on a human cellular system Torsten ... lL of a substrate solution (Promega, Madison, WI, USA; CytoTox96 assay), and after 15 min of incubation, an additional 50 lL of a stop solution. The...

Ngày tải lên: 07/03/2014, 05:20

... models of octaga- lacturonate, using three polygalacturonases (including A. aculeatus polygalacturonase), and concluded that the binding clefts in polygalacturonases can accommodate maximally eight ... liberate monogalacturonic acid as the first and only product on PGA and oligoGalpA. On the basis of its mode of action, PelB should be classified as an exo- polygalacturonase (EC 3.2.1...

Ngày tải lên: 20/02/2014, 03:20

... CTGCTGTAATAATGGGTAGAAGG ARA439 GGAATTC CATATGCGTATTATGGCCAG ARA440 TATTTA CTCGAGAATCCCCTCCTCAGC ARA444 CG GGATCCACCGTGAAAAAGAAAGAATTGTC ARA451 GAATTCATAAAG AAGCTTTGTCTGAAGC ARA456 CGGCGCGT CATATGGCCAGTCATGATA ARA457 ... CGGCGCGT CATATGGCCAGTCATGATA ARA457 TGATACG CATATGTCACCGGCTGGC ARA458 CTCAGCCAATTTGGTTACATCCTTGTCCAAGTCAATCAGAATGCCAGCCGGTGCCAC ARA459 GTGTCACCGGCTGGCATTCTGATTGACTTGGACAAGGATG...

Ngày tải lên: 14/03/2014, 23:20

... Philadelphia, Pa. 19104 ABSTRACT: The design and implementation of a paraphrase component for a natural language questlon-answer system (CO-OP) is presented. A major point made is the role of ... the auxiliary verb. The cycle of transformations invoked thru application of negation is completed with the contraction transformation. The statement of the contraction...

Ngày tải lên: 21/02/2014, 20:20

... assembly. Variants of CAI peptide Armed with this structural information on CAI, Zhang et al. [32] used a structure-based rational design approach to stabilize the a- helical structure of CAI and also ... and Gln192) is one of the residues that decreases the association constant of CTD, as previously demonstrated in an alanine scanning of the dimerization interface [23]. Barkli...

Ngày tải lên: 18/02/2014, 06:20

... from human adenocarcinomas Anna Maria Luciani 1 , Sveva Grande 1 , Alessandra Palma 1 , Antonella Rosi 1 , Claudio Giovannini 2 , Orazio Sapora 3 , Vincenza Viti 1 and Laura Guidoni 1 1 Dipartimento ... arachidonic acid chains, and at 0.93–2.04 p.p.m., attributed to linolenic acid chains on the basis of a comparison with lipid extracts and from the data available in the literature, ar...

Ngày tải lên: 18/02/2014, 13:20

... (5¢-CCATGAAGTCCGCGAATC-3¢); and QsCgClp2 (5¢-GCATAGCGATGTGGACGA-3¢) and QaCgClp2 (5¢-GAGGACCGAGACCGTGAA-3¢). The abbreviations ‘Qs’ and ‘Qa’ refer, respectively, to sense and antisense primers. Accurate ... generated by 5¢- and 3¢-RACE using the Marathon cDNA amplification kit (Clontech, Takara, Mountain View, CA, USA). Double- stranded cDNA from oyster mantle edges was ligated to adaptors, an...

Ngày tải lên: 19/02/2014, 00:20

... with a splicing junction. Confirmation of utilization of exon 1a as a transcription initiation exon and occurrence of alternative splicing To examine whether exon 1a is used as a transcription starting ... Kominato Y, Yamamoto F & Takizawa H (2002) Characterization of the human ABO gene pro- moter in erythroid cell lineage. Vox Sang 82, 39–46. 34 Yasuda T, Awazu S, Sato...

Ngày tải lên: 19/02/2014, 06:20

... Characterization of the interaction between the plasma membrane H + -ATPase of Arabidopsis thaliana and a novel interactor (PPI1) Corrado Viotti, Laura Luoni, Piero Morandini and Maria Ida ... regula- tion of proton pumping activity in different cells types and physiological conditions takes place at both the transcriptional and translational levels [1–4]. As to post-translational r...

Ngày tải lên: 19/02/2014, 07:20

... 5¢-CTTTAACTTGTTGGGCACTGG CATTG-3¢; NP6, 5¢-TTGATCGATTCTGTCTATGCCC CA-3¢ along with the adaptor primers: AP1 (5¢-GTAATAC GACTCACTATAGGGC-3¢) and AP2 (5¢-ACTATAGGG CACGCGTGGT-3¢). Nested PCR was carried ... PCR was performed in 50 lL containing 1 ng of genomic DNA as template, 0.2 mm dATP, dCTP, dGTP and dTTP, 0.2 lm of upstream primer (OP17: 5¢-GA AAAACCATGGTGAATGAATACCAAGCGACT-3¢ ) and do...

Ngày tải lên: 19/02/2014, 07:20