The Making of a European Constitution Judges and Law Beyond Constitutive Power docx
... plays a daily and vital role in the shaping and the controlling of the character and relative governing powers of European institutions, such as the European Parliament, European Commission and ... reflexivity) and, further, sustains and orders societal contestation (legal universalism) within Europe, the constitutional activities and aspirations of Europ...
Ngày tải lên: 07/03/2014, 02:20
... consists of a federation of 11 states in Peninsular Malaysia and the states of Sabah and Sarawak in the north of Kalimantan. Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia ... part of South-East Asia and occupies a total land area of 330,434 square kilometres. The land mass comprises three main components: Peninsular Malaysia...
Ngày tải lên: 06/03/2014, 15:21
... (R) CTCACCACAGACGATWTCC PLA5G2 (F) CGGTAAGCCCATAACGCCCA PLA3G2 (R) CAGGCCAGGATTTGCAGCC PLA3G4 (R) CATAAACAYGAGCCAGTTGCC ARTF a (F) GAGTGGATGCACAGTCGTTG ARTR a (R) GAAACGGAGGTAGTGACACAT AtxBF b (F) ... GCCTGCTCGAATTCGGGATG AtxBrc b (R) CTCCTTCTTGCACAAAAAGTG AtxACF c (F) CTGCTCGAATTCGGGATG AtxACrc c (R) GTCYGGGTAATTCCTATATA AmlF d (F) GTGATCGAATTTGGGAAGATGATCCA Amlrc d (R) CCCTTGCATTTAAACCT...
Ngày tải lên: 17/03/2014, 03:20
The mandibles of a mantis are strong and sharp enough to cut human flesh potx
... The mandibles of a mantis are strong and sharp enough to cut human flesh *The mandibles of a mantis are strong and sharp enough to cut human flesh. Hình thức ngữ pháp, cấu trúc : “adj/adv ... đó) The mandibles of a mantis are strong and sharp enough to cut human flesh. 2. Các bạn hãy di chuột vào từng cụm từ một để biết chức năng c a cụm trong câu: The...
Ngày tải lên: 02/04/2014, 21:21
Tài liệu Báo cáo khoa học: Induction of uPA gene expression by the blockage of E-cadherin via Src- and Shc-dependent Erk signaling docx
... and 5¢-CAUGUACCGAACCAAGUAGGA-3¢; control siRNA 5¢-GUACCUGACUAGUCGCAGAAG-3¢ and 5¢-UCUG CGACUAGUCAGGUACGG-3¢. The specificities of these sequences were confirmed by blasting against the Gen- Bank ⁄ EMBL database. Immunoprecipitation ... for the for- mation of epithelia in the embryo and the maintenance of the polarized epithelial structure in the adult [2]. As a singl...
Ngày tải lên: 19/02/2014, 05:20
The Hero of Ticonderoga or Ethan Allen and his Green Mountain Boys docx
... opposite Ethan. Ira was thirteen years younger than Ethan, but as bold and daring as his brother. At the date of the formation of the Green Mountain Boys, Ira was eighteen, and as bright a lad as ever CHAPTER ... club fashion, and would have brained the speaker had not Isaac Gerston, one of the posse, caught his arm. "Father Abraham!" he ejaculated, "are...
Ngày tải lên: 17/03/2014, 23:20
Factors influencing borrower’s behavior and decision making patterns in the success of a micro finance model
... support to MFIs amongst lower income populations. The data was tabulated and analyzed through qualitative analysis of the gathered data, which reveal the behaviors and decision making patterns in ... that they are at the mercy of the MFIs and they do not have any idea about the merits of the loan products. They will have higher satisfaction and confidence if...
Ngày tải lên: 06/09/2013, 05:48
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System
... in nature to a data manager which fails to free data, but is easier to detect and prevent. • Data manager changes data. A malicious data manager may change the value of its data on each cache refresh. ... when the data manager relinquishes that memory. If the data manager does not process and release the data within an adequate period of time, the data may then be paged...
Ngày tải lên: 12/09/2012, 15:05
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
... of the initiation of NARP in 2003. The study in- cluded the data obtained from all of the four univer- sity hospitals, and one referral tertiary-care educa- tional state hospital in Ankara. These ... expenditure and cost: Aggregate amount of antibiotic consumption as total weight (gram) and number of boxes were calculated from two databases, 1) Hospital pharmacy com...
Ngày tải lên: 25/10/2012, 11:00