Báo cáo khoa học: Inactivating pentapeptide insertions in the fission yeast replication factor C subunit Rfc2 cluster near the ATP-binding site and arginine finger motif docx
... focus on the Rfc2 protein (also known as RFC-D). Rfc2 binds ATP in site D at the Rfc2 Rfc5 (RFC-D–RFC-E) interface and contributes an arginine finger to site C at the Rfc3 Rfc2 (RFC -C RFC-D) interface. ... 2009 The Authors Journal compilation ª 2009 FEBS 4813 Inactivating pentapeptide insertions in the fission yeast replication factor C sub...
Ngày tải lên: 07/03/2014, 02:20
... their treatment decisions on the cow's characteristics. They focussed generally on the practical use of the score to support treatment of each individual cow, indicating that decisions can ... ('signif- icance testing'). Hence sources of variation and bias (poor accuracy and precision) in centrally collected data files including unstructured human influence must be...
Ngày tải lên: 25/10/2012, 10:45
... GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC RPE6 5c- His-Fwd NM_001113653 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC Y. Takahashi et al. A novel isomerohydrolase in the retina FEBS ... CTTTTGTGTAGGTGGGATTCG 13cIMH GSP-Fwd NM_001089433 CTGAGGTTACAGACAACTGTTC 13cIMH GSP-Rev CCTTTGACATCGCAAGTGGATCA RPE6 5c GSP-Fwd NM_001113653 TTGAGGTGACAGACAATTGCCT RPE6 5c GSP-Rev TCTTT...
Ngày tải lên: 14/02/2014, 14:20
Tài liệu Báo cáo khoa học: TEC family kinases in health and disease – loss-of-function of BTK and ITK and the gain-of-function fusions ITK–SYK and BTK–SYK pptx
... affect residues directly involved in ligand binding, presumably abolishing the interaction with signaling partners. The remaining mutations alter amino acids located outside the ligand-binding ... to the wider scienti c community. In the same year, the xid (X-linked immunodeficiency) mouse was recog- nized as a spontaneously occurring animal disease model for inactivating mu...
Ngày tải lên: 14/02/2014, 18:20
Tài liệu Báo cáo khoa học: RMI1 deficiency in mice protects from diet and genetic-induced obesity pptx
... up-regulated in the liver and adipose tissue of KK-A y mice. RMI1 is a component of the Bloom’s syndrome gene helicase complex that maintains genome integrity and activates cell-cycle checkpoint machinery. ... (BLM)–topoisomerase complex [10]. This complex is essential for the maintenance of genome integrity, and can activate the cell-cycle checkpoint machinery [11,12]. Deplet...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: SREBPs: SREBP function in glia–neuron interactions pdf
... out- growth and increases synaptogenesis. Intriguingly, recent insights indicate that astrocytes may do this not only via direct contact [36], but also via secreted factors, which include fatty acids and ... synthesized by Schwann cells in the PNS, and by oligodendrocytes in the CNS. The electrical insulating property of the myelin membrane is pro- vided by its high and ch...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu Báo cáo khoa học: Transcriptional upregulation of inflammatory cytokines in human intestinal epithelial cells following Vibrio cholerae infection pptx
... in ammatory response in intestinal epithelial cells, and the potential contribution of individual V. cholerae components to cytokine induction. The speci c components include lipopolysacccharide (LPS), any secreted ... observed in the nature of the cytokine expression profile following V. cholerae infection in the ileocecal epithelial carcinoma cell line Caco-2 as com- pare...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf
... plasticity and the promotion of cardiac protection in ischemia and ischemic preconditioning. J Mol Cell Cardiol 34, 1077– 1089. 8 Stanley WC (2004) Myocardial energy metabolism during ischemia and the ... luciferase. The reaction of the luciferin ⁄ luciferase mixture, energy donor (ATP) and oxygen results in the emission of light. The intensity of the bioluminescence...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf
... recorded in the trace and retrace directions were observed, indicating that the scanning pro- cess did not in uence the appearance of the sample. For image processing, individual particles of the ... transferred into the system, and the c rings (partly) dissociated into single subunits and subcomplexes. The mass spectrum in Fig. 4B was used to determine the c...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: Bone morphogenetic proteins in the early development of zebrafish pptx
... Follistatin, Chordin and Noggin [12]. These proteins are antagonists of BMP and other members of the TGF-b family, binding to and inhibit- ing these signaling molecules from binding to their receptors ... enhancement of the Tld ⁄ BMP-1 medi- ated cleavage rate of Chordin, which may change the preference of site utilization; and (c) promotion of the dissociation of Chordin cy...
Ngày tải lên: 19/02/2014, 00:20