Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc

Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc

Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc

... CAGGCTCGTGGTGCTAAATGCCCGAACTGCCTGTGCTGTG 3f GTAAGTACGGCTTCTGCGGTTCTGGTGACGCTTACTGTGG 4f CGCTGGTTCTTGCCAGTCTCAGTGCCGTGGTTGCTAG GGAT 1r TTTAGCACCACGAGCCTGGTCACCGCAACGCTGAGC 2r CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG 3r ... CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG 3r GACTGGCAAGAACCAGCGCCACAGTAAGCGTCACCA Reverse GCTA GGATCCCTAGCAACCACGGCAC Table 2. Antifungal activity of WAMP- 1a. IC 50 is the concent...

Ngày tải lên: 07/03/2014, 02:20

10 505 0
Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx

Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx

... Victoria, Australia 3 INSERM U428, Faculte ´ de Pharmacie, Universite ´ Paris V, Paris, France 4 Departments of Pathology and Laboratory Medicine, Pharmacology, and Medicine, Carolina Cardiovascular ... FEBS (GAGs) [3]. Glycosaminoglycans such as heparin, hep- aran sulfate and dermatan sulfate have been found to significantly accelerate the interaction between serpins and coagulation proteases...

Ngày tải lên: 20/02/2014, 02:21

10 669 0
Tài liệu Báo cáo khoa học: Comparative studies of endonuclease I from cold-adapted Vibrio salmonicida and mesophilic Vibrio cholerae docx

Tài liệu Báo cáo khoa học: Comparative studies of endonuclease I from cold-adapted Vibrio salmonicida and mesophilic Vibrio cholerae docx

... GCTTTTAAAGTTGACTTCAAAG 2 CTTTGAAGTCAACTTTAAAAGC 3 CTA CCATGGCACCTCCTTCTTCTTTCTCAA 4 GCT GTCGACTTATTTAGTGCATGCTTTATAAACAA 5 CTA CCATGGCCCCCATCTCTTTTAGTCAT 6 GCT GTCGACTCAGTTCGGGCATTGCTCAC B. Altermark ... towards dsDNA, ssDNA and plasmid were analyzed using linearized pBAD ⁄ gIII plasmid, linea- rized and denatured plasmid and intact plasmid. The pBAD ⁄ gIII plasmid was linearized using SalI a...

Ngày tải lên: 19/02/2014, 05:20

12 565 0
Tài liệu Báo cáo khoa học: Two novel variants of human medium chain acyl-CoA dehydrogenase (MCAD) K364R, a folding mutation, and R256T, a catalytic-site mutation resulting in a well-folded but totally inactive protein pptx

Tài liệu Báo cáo khoa học: Two novel variants of human medium chain acyl-CoA dehydrogenase (MCAD) K364R, a folding mutation, and R256T, a catalytic-site mutation resulting in a well-folded but totally inactive protein pptx

... by site-directed PCR-based mutagenesis [12,30]. Mutagenic antisense oligonucleotides for MCAD  842GfiC(5¢-GAT AAAACCACACCTGTAGTAGCTG-3¢) and MCAD 116 5A G(5¢-CCTGTAGAAAGACTAATGAGGGATG CC-3¢) (mutagenic substitutions ... 548–556. 15 Ikeda Y, Okamura-Ikeda K & Tanaka K (1985) Purifi- cation and characterization of short-chain, medium- chain, and long-chain acyl-CoA dehydrogenases from rat...

Ngày tải lên: 20/02/2014, 02:21

9 533 0
Báo cáo khoa học: "Circadian pattern of activation of the medical emergency team in a teaching hospita"

Báo cáo khoa học: "Circadian pattern of activation of the medical emergency team in a teaching hospita"

... staff should be available on a 24-hour basis to assess and treat acutely ill hospital patients. Utilization of a MET system has been associated with a reduc- tion in all-cause hospital mortality ... paging system, and a detailed log of all calls is maintained. Criteria for medical emergency team activation Calling criteria for our MET service are based on acute changes in heart rate...

Ngày tải lên: 25/10/2012, 10:45

4 541 0
Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt

Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt

... this domain was found in some closely related bacterial species, but mainly in nonvertebrate animals, and invariably connected via a linker to an animal-type a- amylase (listed in Table S1), as shown ... gigas (Mollusca, Bivalvia). Sequence data were depos- ited in GenBank (Table S1). Searches in databases Using the putative C-terminal domain of C. fluminea as a query, sequence databases...

Ngày tải lên: 14/02/2014, 18:20

8 625 0
Tài liệu Báo cáo khoa học: Modeling of tRNA-assisted mechanism of Arg activation based on a structure of Arg-tRNA synthetase, tRNA, and an ATP analog (ANP) ppt

Tài liệu Báo cáo khoa học: Modeling of tRNA-assisted mechanism of Arg activation based on a structure of Arg-tRNA synthetase, tRNA, and an ATP analog (ANP) ppt

... molecular mechanism for the Arg-tRNA synthetase-catalyzed deacylation of Arg- tRNA (Arg-tRNA + AMP fi Arg-AMP + tRNA at high pH), in which the deacylation of aminoacyl-tRNA bound on Arg-tRNA synthetase ... MgCl 2 under a linear gradient of NaCl from 0 to 2 m gave a pure tRNA Arg transcript, which was precipitated by addition of ethanol. Aminoacylation reaction The aminoacylation reaction...

Ngày tải lên: 18/02/2014, 11:20

17 512 0
Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

... AAG CCG ATG ACA CCA ATT (asd sense) This study asd2 GCA GGT TCA TAG TGC ATG (asd antisense) This study Kan RP GGT GCG ACA ATC TAT CGA (kanamycin sense) [19] Kan FP CTC ATC GAG CAT CAA ATG (kanamycin ... Branhamella catarrhalis: an organism gaining respect as a pathogen. Clin Microbiol Rev 3, 293–320. 2 Karalus R & Campagnari A (2000) Moraxella catarrh- alis: a review of an important...

Ngày tải lên: 18/02/2014, 14:20

14 675 0
Tài liệu Báo cáo khoa học: Understanding the binding properties of an unusual metal-binding protein ) a study of bacterial frataxin pdf

Tài liệu Báo cáo khoa học: Understanding the binding properties of an unusual metal-binding protein ) a study of bacterial frataxin pdf

... of bacterial frataxin Chiara Pastore 1 , Marisa Franzese 2 , Filomena Sica 2,3 , Pierandrea Temussi 1,2 and Annalisa Pastore 1 1 National Institute for Medical Research, London, UK 2 Dipartimento ... the transversal relaxation. Conversely, two equivalents of the ion cause the shift and disappearance of several signals, without the concomitant appearance of any new resonance. This anomalous be...

Ngày tải lên: 18/02/2014, 16:20

12 704 0
Tài liệu Báo cáo khoa học: Influence of modulated structural dynamics on the kinetics of a-chymotrypsin catalysis Insights through chemical glycosylation, molecular dynamics and domain motion analysis pptx

Tài liệu Báo cáo khoa học: Influence of modulated structural dynamics on the kinetics of a-chymotrypsin catalysis Insights through chemical glycosylation, molecular dynamics and domain motion analysis pptx

... combination was possible because both the dynamic and catalytic parameters derived Table 4. Kinetic parameters for the a- CT-, lactose -a- CT-, and dextran -a- CT catalyzed hydrolysis of Suc-Ala-Ala-Pro-Phe-pNA ... bonds, and solvent accessible surface areas were calculated with YASARA’s analysis module. Gaussian network model analysis GNM analysis represents a simplified version of norma...

Ngày tải lên: 19/02/2014, 05:20

17 531 0
w