Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc

... CAGGCTCGTGGTGCTAAATGCCCGAACTGCCTGTGCTGTG3f GTAAGTACGGCTTCTGCGGTTCTGGTGACGCTTACTGTGG4f CGCTGGTTCTTGCCAGTCTCAGTGCCGTGGTTGCTAGGGAT1r TTTAGCACCACGAGCCTGGTCACCGCAACGCTGAGC2r CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG3r ... CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG3r GACTGGCAAGAACCAGCGCCACAGTAAGCGTCACCAReverse GCTAGGATCCCTAGCAACCACGGCACTable 2. Antifungal activity of WAMP- 1a. IC50is the concentrationnecessary for 50% growth inhibition.Fungi ... Odintsova1, Alexander A. Vassilevski2, Anna A. Slavokhotova1,Alexander K. Musolyamov2, Ekaterina I. Finkina2, Natalia V. Khadeeva1, Eugene A. Rogozhin2,Tatyana V. Korostyleva1, Vitalii...

Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx

... Victoria, Australia3 INSERM U428, Faculte´de Pharmacie, Universite´Paris V, Paris, France4 Departments of Pathology and Laboratory Medicine, Pharmacology, and Medicine, Carolina Cardiovascular ... FEBS(GAGs) [3]. Glycosaminoglycans such as heparin, hep-aran sulfate and dermatan sulfate have been found tosigniﬁcantly accelerate the interaction between serpinsand coagulation proteases, usually ... Calcium enhances heparin catalysisof the antithrombin-Factor Xa reaction by a templatemechanism: Evidence that calcium alleviates Gladomain antagonism of heparin binding to Factor Xa.J Biol...

Tài liệu Báo cáo khoa học: Comparative studies of endonuclease I from cold-adapted Vibrio salmonicida and mesophilic Vibrio cholerae docx

... GCTTTTAAAGTTGACTTCAAAG2 CTTTGAAGTCAACTTTAAAAGC3 CTACCATGGCACCTCCTTCTTCTTTCTCAA4 GCTGTCGACTTATTTAGTGCATGCTTTATAAACAA5 CTACCATGGCCCCCATCTCTTTTAGTCAT6 GCTGTCGACTCAGTTCGGGCATTGCTCACB. Altermark ... towards dsDNA, ssDNA and plasmidwere analyzed using linearized pBAD ⁄ gIII plasmid, linea-rized and denatured plasmid and intact plasmid. ThepBAD ⁄ gIII plasmid was linearized using SalI and ... 2000.00.30.60.91.21.51.8DNaseRNase[NaCl] (mM)Rfu/sFig. 9. DNase and RNase activity with increasing amounts of NaCl. (A) VsEndA; (B) VcEndA. Enzyme was assayed using the DNase-Alert and RNaseAlert QC system...

Tài liệu Báo cáo khoa học: Two novel variants of human medium chain acyl-CoA dehydrogenase (MCAD) K364R, a folding mutation, and R256T, a catalytic-site mutation resulting in a well-folded but totally inactive protein pptx

... bysite-directed PCR-based mutagenesis [12,30]. Mutagenicantisense oligonucleotides for MCAD  842GﬁC(5¢-GATAAAACCACACCTGTAGTAGCTG-3¢) and MCAD116 5A G(5¢-CCTGTAGAAAGACTAATGAGGGATGCC-3¢) (mutagenic substitutions ... 548–556.15 Ikeda Y, Okamura-Ikeda K & Tanaka K (1985) Puriﬁ-cation and characterization of short-chain, medium-chain, and long-chain acyl-CoA dehydrogenases from rat liver mitochondria: isolation ... ofMCAD deﬁciency cover a broad spectrum, ranging from hypoglycaemia to seizures, coma and suddendeath, and usually present at a time of metabolicdecompensation associated with fasting or viral...

Báo cáo khoa học: "Circadian pattern of activation of the medical emergency team in a teaching hospita"

... staff should be available on a 24-hour basis to assess and treat acutely ill hospital patients.Utilization of a MET system has been associated with a reduc-tion in all-cause hospital mortality ... paging system, and a detailed log of all calls is maintained.Criteria for medical emergency team activationCalling criteria for our MET service are based on acutechanges in heart rate (<40 ... activation at half-hourly intervals over a 24-hour period and related this to aspects of nursing and medicaldaily routine.Materials and methodsThe hospitalAustin Health is a university-affiliated...

Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt

... this domain was found insome closely related bacterial species, but mainly innonvertebrate animals, and invariably connected via a linker to an animal-type a- amylase (listed in Table S1),as shown ... gigas (Mollusca, Bivalvia). Sequence data were depos-ited in GenBank (Table S1).Searches in databasesUsing the putative C-terminal domain of C. ﬂuminea as a query, sequence databases were searched ... report a new group of a- amylasesdisplaying a modular organization in which the linkersequences represent a biochemical paradigm that illus-trates the structural parameters required to allow a polypeptide...

Tài liệu Báo cáo khoa học: Modeling of tRNA-assisted mechanism of Arg activation based on a structure of Arg-tRNA synthetase, tRNA, and an ATP analog (ANP) ppt

... molecularmechanism for the Arg-tRNA synthetase-catalyzed deacylation of Arg-tRNA (Arg-tRNA + AMP ﬁ Arg-AMP + tRNA at high pH), in whichthe deacylation of aminoacyl-tRNA bound on Arg-tRNA synthetase ... MgCl2under a linear gradient of NaCl from 0 to 2 m gave a puretRNAArgtranscript, which was precipitated by addition ofethanol.Aminoacylation reactionThe aminoacylation reaction of tRNA was measured ... nucleotides (AGCCA1 7a GGAC2 0a A), respectively.The P. horikoshii tRNAArgCCUgene (5¢-GGACCGGTAGCCTAGCCA1 7a GGAC2 0a AGGG CGGCGGCCTCCTAAGCCGCAGGTCCGGGGTTCAAATCCCCGCCGGTCCGCCA-3¢) was cloned with...

Tài liệu Báo cáo khoa học: Identiﬁcation of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

... AAG CCG ATG ACA CCA ATT (asd sense) This studyasd2 GCA GGT TCA TAG TGC ATG (asd antisense) This studyKan RP GGT GCG ACA ATC TAT CGA (kanamycin sense) [19]Kan FP CTC ATC GAG CAT CAA ATG (kanamycin ... Branhamella catarrhalis: an organismgaining respect as a pathogen. Clin Microbiol Rev 3,293–320.2 Karalus R & Campagnari A (2000) Moraxella catarrh-alis: a review of an important human ... Barenkamp SJ, Robbins JB, Tsai CM,Lim DJ & Battey J (1998) Synthesis and characteriza-tion of lipooligosaccharide-based conjugates as vaccinecandidates for Moraxella (Branhamella) catarrhalis.Infect...

Tài liệu Báo cáo khoa học: Understanding the binding properties of an unusual metal-binding protein ) a study of bacterial frataxin pdf

... of bacterial frataxinChiara Pastore1, Marisa Franzese2, Filomena Sica2,3, Pierandrea Temussi1,2and Annalisa Pastore11 National Institute for Medical Research, London, UK2 Dipartimento ... thetransversal relaxation. Conversely, two equivalents ofthe ion cause the shift and disappearance of severalsignals, without the concomitant appearance of anynew resonance. This anomalous behavior ... mapped onto a semicon-served negatively charged ridge that contains severalsemiconserved glutamate and aspartate side chains[21,24,25]. In agreement with the absence of featuresthat are assumed...

Tài liệu Báo cáo khoa học: Inﬂuence of modulated structural dynamics on the kinetics of a-chymotrypsin catalysis Insights through chemical glycosylation, molecular dynamics and domain motion analysis pptx

... combination was possible becauseboth the dynamic and catalytic parameters derivedTable 4. Kinetic parameters for the a- CT-, lactose -a- CT-, and dextran -a- CT catalyzed hydrolysis of Suc-Ala-Ala-Pro-Phe-pNA ... bonds, and solvent accessible surfaceareas were calculated with YASARA’s analysis module.Gaussian network model analysisGNM analysis represents a simpliﬁed version of normalmode analysis ... Solvent accessible surface areas calculatedfor a- CT and the various lactose -a- CT conjugate struc-tures modeled.Table S4. Average rmsd (A ˚) for the conserved catalyticresidues calculated from...

Xem thêm