Báo cáo khoa học: A study on genomic distribution and sequence features of human long inverted repeats reveals species-specific intronic inverted repeats pptx

... Journal 276 (2009) 1986–1998 ª 2009 The Authors Journal compilation ª 2009 FEBS A study on genomic distribution and sequence features of human long inverted repeats reveals species-specific intronic ... also show that inverted repeats are essential for the initiation of DNA replication in plas- mids, bacteria, eukaryotic viruses and mammalian cells [24]....

Ngày tải lên: 07/03/2014, 00:20

... profes- sional indexers are used as a gold standard, that is, the manual keywords are treated as the one and only truth. The evaluation measures are preci- sion (how many of the automatically assigned ... experiments. The approach taken to the automatic keyword extraction is that of supervised machine learning, and the prediction models were trained on man- ually annotated data. N...

Ngày tải lên: 08/03/2014, 02:21

... words and (b) the classification of the argument type, e.g. Arg0 or ArgM in PropBank or Agent and Goal in FrameNet. The standard approach to learn both detec- tion and classification of predicate arguments is ... ex- ample of a non-linear separable function that becomes separable in a superlinear space (Cris- tianini and Shawe-Taylor, 2000). After it was established that the b...

Ngày tải lên: 08/03/2014, 04:22

... SLM was trained on 20M words of WSJ text automatically parsed using the parser in (Ratnaparkhi, 1997), bi- narized and enriched with headwords and NT/POS tag information as explained in Section ... to carry over to the test data. 2.2 Headword Percolation And Binarization As explained in the previous section, the SLM is ini- tialized on parse trees that have been binarized and th...

Ngày tải lên: 23/03/2014, 20:20

... 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab- start, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢;Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢. The PCR solution was prepared ... and using the following primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢;Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTC GCTGAA GACGT GGGTTCT AACAAG GGTGCT-3¢;Abc, 5¢-C...

Ngày tải lên: 18/02/2014, 13:20

... that parallel-stranded G-quadruplex- es give a positive peak at 260 nm and a negative peak at 240 nm, whereas antiparallel-stranded G-quadru- plexes give a positive peak at 290–295 nm and a nega- tive ... G-to -A mutation that was designed to specifically disrupt potential quadruplex formation did not induce a significant conformational change. A slightly faster migration of...

Ngày tải lên: 29/03/2014, 21:20

... publicly available datasets and a number of them repeatedly demonstrated significant in- creases in accuracy compared to other state -of- the- art approaches. We demonstrated that for accurate classification ... LIBLINEAR library (Fan et al., 2008). We use a linear kernel and default parameters. All results are based on leave-one out cross validation accuracy. The reason for this ch...

Ngày tải lên: 20/02/2014, 04:20

... MINIREVIEW A study of microRNAs in silico and in vivo: diagnostic and therapeutic applications in cancer Scott A. Waldman 1 and Andre Terzic 2 1 Departments of Pharmacology and Experimental Therapeutics ... S, Cordon-Cardo C, Lowe SW, Hannon GJ et al. (2005) A microRNA poly- cistron as a potential human oncogene. Nature 435, 828–833. 39 Hayashita Y, Osada H, Tatematsu Y...

Ngày tải lên: 16/03/2014, 01:20

... developmental stages and the changes of these networks in disease and after applica- tion of a variety of therapeutic strategies. Critically, the noninvasive imaging approach of miRNA genera- tion and ... for target identification and for elucidating the functional relationship between miRNA and its targets (Fig. 1F) [13,24–28]. Computer database programs, such as the PicTa...

Ngày tải lên: 16/03/2014, 01:20

... the Translation Scheme Three dictionaries are envisaged: a stem dictionary, a prefix dictionary, and a suffix dictionary. If one were dealing with suffixes only (rather than with suffixes and ... Bundoora, Victoria, Australia Some features of the morphology of Swahili are discussed from the point of view of mechanizing a dictionary. A preliminary program is describ...

Ngày tải lên: 23/03/2014, 13:20