Báo cáo khoa học: Effects of a novel arginine methyltransferase inhibitor on T-helper cell cytokine production pot

... Purandare AV, Chen Z, Huynh T, Pang S, Geng J, Vaccaro W, Poss MA, Oconnell J, Nowak K & Jayar- aman L (2008) Pyrazole inhibitors of coactivator associ- ated arginine methyltransferase 1 (CARM1). ... Surface-scanning mutational analy- sis of protein arginine methyltransferase 1: roles of specific amino acids in methyltransferase substrate spec- ificity, oligomerization, and...

Ngày tải lên: 06/03/2014, 11:20

... Ohno-Iwashita Y, Shimada Y, Waheed AA, Hayashi M, Inomata M, Nakamura M, Maruya M & Iwashita S (2004) Perfringolysin O, a cholesterol-binding cytolysin, as a probe for lipid rafts. Anaerobe ... Davidson D, Bakinowski M, Thomas ML, Horejsi V & Veillette A (2003) Phosphorylation-dependent regulation of T -cell activation by PAG ⁄ Cbp, a lipid raft-associated transmembrane ada...

Ngày tải lên: 20/02/2014, 03:20

... metabolite Prashant N. Jethva, Jay R. Kardani and Ipsita Roy Department of Biotechnology, National Institute of Pharmaceutical Education and Research (NIPER), S .A. S. Nagar, India Introduction The inability of ... effect of 50 lm dopamine on the aggregation process. Dopamine delayed the lag phase of aggregation marginally to 95.5 h from 86.8 h in the presence of MPTP alone. The...

Ngày tải lên: 14/02/2014, 19:20

... GTATGCGATGTGGAATTTG Spcoq3-m GATGCCTTCCAATGAATTAC cyc1-w GAACCAATGAAATAAGGGCG cyc1-x GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC cyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG cyc1-z GCATCAGAAAGCATAGGC cyc1-m ... GTACAAGCTTGTAAATTTTCGATGG Spcoq7-b CATAGAATTCTTGGTAATC Spcoq7-c AAAGTCGACATGTTGTCACGTAGACAG Spcoq7-w CAAGCAGGTGAATTAGGC Spcoq7-x GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATC Spcoq7-...

Ngày tải lên: 18/02/2014, 14:20

... 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter. The ... Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from murine tissues. Chara...

Ngày tải lên: 18/02/2014, 17:20

... °C was incubated over time. Free ligands were adsorbed on charcoal, and the absorbance spectra were recorded. Concentration of appearing IF–CNCbl was calculated by comparison with the standards ... dissociation spanned at least 90% of the total amplitude, which allows one to describe the reaction as a unidirectional process and fit it by exponential approximation. Sur- prisingly, the m...

Ngày tải lên: 19/02/2014, 05:20

... fraction of the target is no longer accessible to other kinases and phosphatases. Available data about phosphatase concentrations sug- gest that they are also likely to be of the same order of magnitude ... is appealing because of its simplicity: all it needs is one modification site on a protein that acts as a sub- strate (e.g. a phosphorylation site) and, for example, a kin...

Ngày tải lên: 19/02/2014, 07:20

... 5¢-CTTTAACTTGTTGGGCACTGG CATTG-3¢; NP6, 5¢-TTGATCGATTCTGTCTATGCCC CA-3¢ along with the adaptor primers: AP1 (5¢-GTAATAC GACTCACTATAGGGC-3¢) and AP2 (5¢-ACTATAGGG CACGCGTGGT-3¢). Nested PCR was carried ... PCR was performed in 50 lL containing 1 ng of genomic DNA as template, 0.2 mm dATP, dCTP, dGTP and dTTP, 0.2 lm of upstream primer (OP17: 5¢-GA AAAACCATGGTGAATGAATACCAAGCGACT-3¢ ) and do...

Ngày tải lên: 19/02/2014, 07:20

... Williams AT&T Labs – Research, Shannon Laboratory 180 Park Ave., Florham Park, NJ 07932, USA jdw@research.att.com Abstract This is a demonstration of a voice di- aler, implemented as a partially observable Markov ... The POMDP and con- ventional dialog manager run in parallel; the con- ventional dialog manager nominates a set of one or more allowed actions, and the POMDP choos...

Ngày tải lên: 20/02/2014, 09:20

... Marchese, S., Brandazza, A. , Ferrara, L., Pelosi, P. & Scaloni, A. (2001) Bacterial expression and conformational analysis of a chemosensory protein from Schistocerca gregaria. Eur. J. Biochem. ... J C. & Masson, C. (1997) Biochemical characterization, molecular cloning and localization of a putative odorant-binding protein in the honey bee Apis mellifera L. (Hymenoptera: A...

Ngày tải lên: 21/02/2014, 03:20