Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

... hnRNP A1 C UAGACUAGA 5428–5437 ESE2 SC35, SRp40 CCAGUAGAUCCUAGACUAGA 5418–5437 A5 ESE GAR ASF ⁄ SF2, SRp40 GAAGAAGCGGAGACAGCGACGAAGA 5558–5582 [7] A7 ESS3 hnRNP A1 , hnRNP E1 ⁄ E2 AGAUCCAUUCGAUUAG unknown 8047–8062 ... 32] ISS hnRNP A1 UAGUGAAUAGAGUUAGGCAGGGA 7928–7950 ESE3 ASF ⁄ SF2 GAAGAAGAA 8016–8025 hnRNP A1 UAGAAGAAGAA 8018–8025 HIV-1 alternative splicing regulation J. Tazi e...

Ngày tải lên: 06/03/2014, 09:22

10 434 0
Báo cáo khoa học: Alternative splicing: role of pseudoexons in human disease and potential therapeutic strategies pot

Báo cáo khoa học: Alternative splicing: role of pseudoexons in human disease and potential therapeutic strategies pot

... concentrations. N Engl J Med 331, 974–980. 88 Faa ` V, Incani F, Meloni A, Corda D, Masala M, Baffico AM, Seia M, Cao A & Rosatelli MC. (2009). Characterization of a disease-associated mutation affect- ing ... JP, Markham AF, Giardina PJ, Li A & Kazazian HH Jr. (1984) Beta-thalassemia in Chinese: use of in vivo RNA analysis and oligonucleotide hybridization in systematic cha...

Ngày tải lên: 06/03/2014, 09:22

15 467 0
Báo cáo khoa học: Alternative splicing: good and bad effects of translationally silent substitutions pdf

Báo cáo khoa học: Alternative splicing: good and bad effects of translationally silent substitutions pdf

... altered isoform proportions, activation of a control mechanism such as nonsense-mediated decay, as well as the creation or loss of splicing variants. As this process has a signifi- cant impact on ... codon information, for an amino acid. Translationally silent variations that affect splicing and disease Clinical studies identifying aberrant splicing mutations are of great i...

Ngày tải lên: 06/03/2014, 09:22

5 437 0
Báo cáo khoa học: Alternative splicing produces an H-protein with better substrate properties for the P-protein of glycine decarboxylase doc

Báo cáo khoa học: Alternative splicing produces an H-protein with better substrate properties for the P-protein of glycine decarboxylase doc

... (1988) Resolution and characterization of the glycine cleavage reaction in pea leaf mitochondria. Properties of the forward reaction catalysed by glycine decarboxylase and serine hydroxymethyltransferase. ... Germany). For exact determination of the mean mass, the protein sample was mixed with an aliquot of protein standard I (Bruker Daltonics) to allow internal calibration, resulti...

Ngày tải lên: 23/03/2014, 04:20

7 394 0
Tài liệu Báo cáo khoa học: miRNAs and regulation of cell signaling pptx

Tài liệu Báo cáo khoa học: miRNAs and regulation of cell signaling pptx

... UGUUGUUUUAGUGAUCAGAAGGU GY-box family miRNA Brd-box: 5´ AGCUUUA ||||||| dme-miR-4 3´ AGUUACCAACAGAUCGAAAUA dme-miR-79 3´ UACGAACCAUUAGAUCGAAAUA Brd-box family miRNAs K-box: 5´ cUGUGAUa |||||| dme-miR- 2a ... target mRNAs in a sequence-specific manner. A large number of genes appear to be the target of miRNAs, and an essential role for miRNAs in the regulation of various co...

Ngày tải lên: 14/02/2014, 19:20

9 684 0
Tài liệu Báo cáo khoa học: Small molecule regulation of Sir2 protein deacetylases ppt

Tài liệu Báo cáo khoa học: Small molecule regulation of Sir2 protein deacetylases ppt

... that an increase in Nmnat1 activity leads to Fig. 2. (A) NAD + salvage pathway in yeast. (B) NAD + salvage pathway in mammals. Small molecule regulation of Sir2 protein deacetylases O. Grubisha ... product formation [38,39]. Nicotin- amide acts as a classical noncompetitive product inhi- bitor of the forward deacetylation reaction and was shown in vivo to decrease gene silencing, in...

Ngày tải lên: 20/02/2014, 01:20

10 475 0
Tài liệu Báo cáo khoa học: Oxygen-dependent regulation of hypoxia-inducible factors by prolyl and asparaginyl hydroxylation pdf

Tài liệu Báo cáo khoa học: Oxygen-dependent regulation of hypoxia-inducible factors by prolyl and asparaginyl hydroxylation pdf

... asparagine in the CAD wassubstitutedwithanasparticacidresidue,FIH-1 hydroxylase activity for the aspartic acid residue was only 7% of that obtained with asparagine. This clear difference in amino ... other asparaginyl hydroxylase enzymes, which can hydroxylate both asparagine and aspartic acid residues, the FIH-1 enzyme was shown to have a clear preference for asparagine in the CAD o...

Ngày tải lên: 20/02/2014, 23:20

10 603 0
Báo cáo khoa học: Calmodulin-mediated regulation of the epidermal growth factor receptor doc

Báo cáo khoa học: Calmodulin-mediated regulation of the epidermal growth factor receptor doc

... or STIM2, acting as a Ca 2+ sensor, located in the ER membrane, are translocated to the plasma membrane and clustered at the ER-plasma membrane junctions after the detection of a shortage of Ca 2+ in ... inositol-1,4,5-trisphosphate; Jak2, Janus kinase 2; JM, juxtamembrane; LD, like domain; NCX, Na + ⁄ Ca 2+ exchanger; NLS, nuclear localization sequence; PKC, protein kinase C; PMCA,...

Ngày tải lên: 06/03/2014, 09:22

16 459 0
Báo cáo khoa học: Alternative splicing: global insights potx

Báo cáo khoa học: Alternative splicing: global insights potx

... Watahiki A, Nakamura M, Arakawa T et al. (2003) Cap analysis gene expression for high-throughput analysis of transcriptional starting point and identification of promoter usage. Proc Natl Acad ... [10] – as well as a global analysis of alternative splicing changes pro- duced as a result of splicing factor knockdown or knockout, provide additional ‘factor-centric’ dataset...

Ngày tải lên: 06/03/2014, 09:22

11 544 0
Báo cáo khoa học: Characterization and regulation of a bacterial sugar phosphatase of the haloalkanoate dehalogenase ppt

Báo cáo khoa học: Characterization and regulation of a bacterial sugar phosphatase of the haloalkanoate dehalogenase ppt

... CTGCTGTAATAATGGGTAGAAGG ARA439 GGAATTC CATATGCGTATTATGGCCAG ARA440 TATTTA CTCGAGAATCCCCTCCTCAGC ARA444 CG GGATCCACCGTGAAAAAGAAAGAATTGTC ARA451 GAATTCATAAAG AAGCTTTGTCTGAAGC ARA456 CGGCGCGT CATATGGCCAGTCATGATA ARA457 ... CGGCGCGT CATATGGCCAGTCATGATA ARA457 TGATACG CATATGTCACCGGCTGGC ARA458 CTCAGCCAATTTGGTTACATCCTTGTCCAAGTCAATCAGAATGCCAGCCGGTGCCAC ARA459 GTGTCACCGGCTGGCATTCTGATTGACTTGGACAAGGATG...

Ngày tải lên: 14/03/2014, 23:20

14 594 0
Từ khóa:
w