Báo cáo khoa học: Comparing the substrate specificities of cytochrome c biogenesis Systems I and II docx

Báo cáo khoa học: Comparing the substrate specificities of cytochrome c biogenesis Systems I and II docx

Báo cáo khoa học: Comparing the substrate specificities of cytochrome c biogenesis Systems I and II docx

... ResC CcdA CcmH CcmG DsbD D CcmB CcmA CcmC p-side p-side Disulfide isomerization Fig. 1. Schematic representation of cytochrome c biogenesis Systems I and II. The systems illustrated are System I ... staining of the gel, of periplasmic fractions from cells expressing P. denitrificans cytochrome c 550 and the indicated biogenesis system (I or II) . The pe...

Ngày tải lên: 06/03/2014, 09:22

12 469 0
Báo cáo khoa học: Probing the substrate specificities of matriptase, matriptase-2, hepsin and DESC1 with internally quenched fluorescent peptides potx

Báo cáo khoa học: Probing the substrate specificities of matriptase, matriptase-2, hepsin and DESC1 with internally quenched fluorescent peptides potx

... a 1 -antitrypsin; a 1 -ACT, a 1 -antichymotrypsin; AT III, antithrombin III; PAI-1, palsminogen activator inhibitor I; a 2 -AP, a 2 -antiplasmin. Inhibitor RCL P4–P4¢ Concentration (n M) Residual activity ... chemical and physiological inhibitors. In a side-by-side comparison, we find that these TTSPs exhibit speci c and distinct biochemical and enzymatic properties. Results Expression...

Ngày tải lên: 23/03/2014, 04:21

14 279 0
Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx

Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx

... an interaction between Tyr315 and the main-chain atoms of Ser14 and Pro15 anchors this loop within the vicinity of the active site, therefore significantly reducing the size and accessibility of the acceptor ... this induction coincides with the expression of pathogen-related proteins and sali- cylic acid synthesis during hypersensitive response initiation [31]. Rec...

Ngày tải lên: 28/03/2014, 23:20

11 661 0
Báo cáo khoa học: Differences in substrate specificities between cysteine protease CPB isoforms of Leishmania mexicana are mediated by a few amino acid changes potx

Báo cáo khoa học: Differences in substrate specificities between cysteine protease CPB isoforms of Leishmania mexicana are mediated by a few amino acid changes potx

... associated with the catalytic triad (L. mexicana residues Cys25, His163 and Asn183; Fig. 4) but the substrate specificity is defined by the bindin g affinities of the subsites. The c atalytic residues ... S 1 ¢-S 3 ¢ subsite specificities determined using a series of fluorogenic peptide derivatives in which substitutions were made on positions P 3 to P 3 ¢ by natural amino ac...

Ngày tải lên: 23/03/2014, 13:20

11 543 0
Báo cáo khoa học: Molecular basis for specificities of reactivating factors for adenosylcobalamin-dependent diol and glycerol dehydratases pptx

Báo cáo khoa học: Molecular basis for specificities of reactivating factors for adenosylcobalamin-dependent diol and glycerol dehydratases pptx

... reactivating factors in the activation of inactive enzyme–CN-Cbl complex The specificities of reactivating factors in the in vitro activation of inactive enzyme–CN-Cbl complexes were studied similarly ... this conclusion. These results are described here. Results Specificities of reactivating factors in the reactivation of inactivated holoenzymes The specificities of...

Ngày tải lên: 16/03/2014, 05:20

11 434 0
Báo cáo khoa học: pH dependence, substrate specificity and inhibition of human kynurenine aminotransferase I ppt

Báo cáo khoa học: pH dependence, substrate specificity and inhibition of human kynurenine aminotransferase I ppt

... hKAT -I, and also provides biochemical information about the s ubstrate specificity and cosubstrate inhibition of the enzyme. hKAT -I is inhibited by Tris under physiological pH conditions, w hich explains ... (5¢- CTCGAGATGGCCAAACAGCTG CAG) and reverse primer (5- AAGCTTAGAGTTCCAC CTTCCACTT) containing a XhoIandaHindIII restriction site (underlined sequence), respectively. The P...

Ngày tải lên: 07/03/2014, 16:20

11 379 0
Báo cáo khoa học: "Comparing the Accuracy of CCG and Penn Treebank Parsers" docx

Báo cáo khoa học: "Comparing the Accuracy of CCG and Penn Treebank Parsers" docx

... form or another; the interesting question is whether any- thing is gained by converting the PTB into CCG. 2 The comparison focuses on accuracy and is per- formed by converting CCG derivations into ... task. There were two approaches we considered for the conversion. One possibility is to associate PTB tree structures with CCG lexical categories, and combine the trees together in...

Ngày tải lên: 17/03/2014, 02:20

4 369 0
Tài liệu Báo cáo khoa học: "Bucking the Trend: Large-Scale Cost-Focused Active Learning for Statistical Machine Translation" docx

Tài liệu Báo cáo khoa học: "Bucking the Trend: Large-Scale Cost-Focused Active Learning for Statistical Machine Translation" docx

... Haffari and Anoop Sarkar. 2009. Active learning for multilingual statistical machine trans- lation. In Proceedings of the Joint Conference of the 47th Annual Meeting of the ACL and the 4th In- ternational ... can indeed buck the trend of diminishing returns, achieving an order of magnitude increase in the rate of improvement in performance. Section 2 discusses rela...

Ngày tải lên: 20/02/2014, 04:20

11 580 0
Tài liệu Báo cáo khoa học: "Bridging the Gap Between Underspecification Formalisms: Minimal Recursion Semantics as Dominance Constraints" docx

Tài liệu Báo cáo khoa học: "Bridging the Gap Between Underspecification Formalisms: Minimal Recursion Semantics as Dominance Constraints" docx

... ϕ and a root of ϕ otherwise. Definition 3. A dominance constraint ϕ is normal (and compact) if it satisfies the following conditions. N1 (a) each variable of ϕ occurs at most once in the labeling ... normal dominance constraints (Koller et al., 2003) do not apply. 2 Minimal Recursion Semantics We define a simplified version of Minimal Recur- sion Semantics and discuss differences...

Ngày tải lên: 20/02/2014, 16:20

8 348 0
Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx

Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx

... amino acid substitution, Leu130Ile, might be involved in an evolutionally critical change in the thermal stabilities of vertebrate DNases I. Amphibian DNasesIhaveaSer205insertioninaCa 2+ -binding ... had significantly low serum DNase I activity levels [13]. These findings indicate that the thermal stabilities of DNase I in vitro might reflect the enzyme activities in vivo.We found...

Ngày tải lên: 20/02/2014, 23:20

8 500 0
w