Báo cáo khoa học: Estrogen-related receptor a and PGC-1-related coactivator constitute a novel complex mediating the biogenesis of functional mitochondria potx

Báo cáo khoa học: Estrogen-related receptor a and PGC-1-related coactivator constitute a novel complex mediating the biogenesis of functional mitochondria potx

Báo cáo khoa học: Estrogen-related receptor a and PGC-1-related coactivator constitute a novel complex mediating the biogenesis of functional mitochondria potx

... 5¢-TAACCCC ACCCTACTAAACC-3¢ and 5¢-GATTATGGGCGTTGA TTAGTAG-3¢; b-globin: 5¢-CAACTTCATCCACGTTCA CC-3¢ and 5¢-ACACAACTGTGTTCACTAGC-3¢. Western blot Cells were rinsed in NaCl ⁄ P i , trypsinized and ... ATP demand. The nuclear transcriptional factors, estrogen-related receptor a (ERRa) and nuclear respiratory factors 1 and 2, are associated with the coordination of the tr...
Ngày tải lên : 06/03/2014, 09:22
  • 13
  • 503
  • 0
Tài liệu Báo cáo khoa học: "Joint Word Segmentation and POS Tagging using a Single Perceptron" docx

Tài liệu Báo cáo khoa học: "Joint Word Segmentation and POS Tagging using a Single Perceptron" docx

... category features and the effect of the tag dictionary. The character category features (templates 15 and 16 in Table 2) represent a Chinese character by all the tags associated with the charac- ter ... a list of characters Variables: candidate sentence item – a list of (word, tag) pairs; maximum word-length record maxlen for each tag; the agenda list agendas; the...
Ngày tải lên : 20/02/2014, 09:20
  • 9
  • 576
  • 0
Tài liệu Báo cáo khoa học: "Paraphrasing Using Given and New Information in a Question-Answer System" docx

Tài liệu Báo cáo khoa học: "Paraphrasing Using Given and New Information in a Question-Answer System" docx

... This example, as well as all sample questions and paraphrases that follow, were, =aken from actual sessions with the paraphraser. Question (A) mad its possible paraphcases (B) and (C) are the ... meaning and of the intentions of the speaker on word or phrase choice. The lack of a rich semantic base and contextual information dictated the syntactic approach u...
Ngày tải lên : 21/02/2014, 20:20
  • 6
  • 532
  • 0
Báo cáo khoa học: "Automatic Grammar Induction and Parsing Free Text: A Transformation-Based Approach" pptx

Báo cáo khoa học: "Automatic Grammar Induction and Parsing Free Text: A Transformation-Based Approach" pptx

... automatic induction of natural language gram- mar. Given the difficulty inherent in manually building a robust parser, along with the availabil- ity of large amounts of training material, auto- ... classification, all words are initially classified as nouns. The naively annotated text is compared to the true annotation as indi- cated by a small manually annotated cor...
Ngày tải lên : 31/03/2014, 06:20
  • 7
  • 254
  • 0
Báo cáo khoa học: Catalytic residues Lys197 and Arg199 ofBacillus subtilis phosphoribosyl diphosphate synthase Alanine-scanning mutagenesis of the flexible catalytic loop ppt

Báo cáo khoa học: Catalytic residues Lys197 and Arg199 ofBacillus subtilis phosphoribosyl diphosphate synthase Alanine-scanning mutagenesis of the flexible catalytic loop ppt

... 5¢-CGCCGTCCGCGTCCAAAC GCCG CGGAAGTCATGAATATTGTAGGTAACATCGAAGGG and 5¢-CCCTTCGATGTTACCTACAATATTCATGACT TCCGC GGCGTTTGGACGCGGACGGCG for V20 4A (pHO393), 5¢-CGTGGCG GCGGTCATGAATATTGTAGG and 5¢-CCTACAATATTCATGAC CGCCGCCACG ... for P20 2A (pHO380), 5¢-CGCCGTCCGCGTCCA GCTGTGGCGGAAGTCATGAATATTGTAGGTAACATC GAAGGG and 5¢-CCCTTCGATGTTACCTACAATATTC ATGACTTCCGCCAC AGCTGGACGCGGACGGCG for N20 3A (...
Ngày tải lên : 23/03/2014, 15:20
  • 9
  • 330
  • 0
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

... collection of the data in and of itself as the basis for taking relevant action at the farm. They may skip the process of systematic anal- ysis of data and give advice based on their immediate eval- uation ... phenomena; 'scoring and recording data on metritis' that relate to the quality of the data that are produced. We analyse and build &apos ;a mode...
Ngày tải lên : 25/10/2012, 10:45
  • 10
  • 587
  • 0
Tài liệu Báo cáo khoa học: PC1⁄3, PC2 and PC5⁄6A are targeted to dense core secretory granules by a common mechanism doc

Tài liệu Báo cáo khoa học: PC1⁄3, PC2 and PC5⁄6A are targeted to dense core secretory granules by a common mechanism doc

... Journal 274 (2007) 4094–4102 ª 2007 The Authors Journal compilation ª 2007 FEBS is autocatalytically cleaved, a central catalytic domain comprising the catalytic triad of amino acids aspartic acid, ... family of secre- ted serine proteases that cleave their substrates at basic amino acids, thereby activating a variety of hormones, growth factors, and viruses. PC1 ⁄ 3, PC2 and...
Ngày tải lên : 18/02/2014, 16:20
  • 9
  • 600
  • 0
Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

... elegans, the fruitflies D. melanogaster and D. pseudoobscura, the mos- quitoes A. aegypti and A. gambiae, the clam T. gigas and larval sequences from the cnidarian F. scutaria. Finally, we chose an ... widespread in the Archaea and Bacteria domains [11]. Among the broad range of physiological processes in which they participate, CA can play a significant role in autotr...
Ngày tải lên : 18/02/2014, 16:20
  • 14
  • 591
  • 0
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

... identify the extracellular ligands of the RPTPs in the neuromuscular system. For example, it is known that PTPd and an isoform of LAR can interact homophilically [39] and that LAR can also bind heterophilically ... black dots, protease cleavage sites. (B) SDS ⁄ PAGE separation of FN3d–AP purified from conditioned media using anti-placental alkaline phosphatase (PLAP) agarose. (...
Ngày tải lên : 19/02/2014, 05:20
  • 14
  • 669
  • 0
Tài liệu Báo cáo khoa học: Physico-chemical characterization and synthesis of neuronally active a-conotoxins docx

Tài liệu Báo cáo khoa học: Physico-chemical characterization and synthesis of neuronally active a-conotoxins docx

... frameworks of the A superfamily without distinction. The A superfamily is so far comprised of the K + channel blocking jA familiy and the a and aA families, which together with the w family act at the ... be applicable to synthesis of a- conopeptides. Synthesis of variants of a- conotoxins: alanine scans and loop replacements In addition to replication of...
Ngày tải lên : 19/02/2014, 12:20
  • 11
  • 554
  • 0

Xem thêm

Từ khóa: