Báo cáo khoa học: The A domain of fibronectin-binding protein B of Staphylococcus aureus contains a novel fibronectin binding site pdf
Báo cáo khoa học: The transmembrane domain of subunitbof theEscherichia coli F1FOATP synthase is sufficient for H + -translocating activity together with subunitsaandc doc
... mitochondria, c hloroplasts and Bacteria. They reversibly catalyze the < /b> synthesis of < /b> ATP from ADP and inorganic phosphate by use of < /b> an electrochemical ion gradient, which is generated across the < /b> membrane ... concentrations of < /b> F O , ac subcomplex and s ubunit b by conventional c olourimetric assays revealed to be biased by partial i mpurities of < /b> t he...
Ngày tải lên: 23/03/2014, 13:20
Tài liệu Báo cáo khoa học: The cellulosomes from Clostridium cellulolyticum Identification of new components and synergies between complexes ppt
... family of < /b> the < /b> catalytic module and the < /b> modular organization of < /b> the < /b> protein,< /b> or on the < /b> identity of < /b> the < /b> catalytic domain < /b> with another characterized protein < /b> (see text). Protein < /b> GI number a < /b> Modular ... GH5 catalytic domain < /b> shows 33% identity with a < /b> mannanase from Bacillus circulans (accessi...
Ngày tải lên: 18/02/2014, 08:20
Báo cáo khoa học: The 2-oxoacid dehydrogenase multi-enzyme complex of the archaeon Thermoplasma acidophilum ) recombinant expression, assembly and characterization docx
... CCG CTCGAGTCAGATCTCGTAGAT TATAGCGTTCGG E3 forward: CTACGAGA GCTAGCATGTACGATGC AATAATAATAGGTTC E3 reverse: TTTAAAAATG GAATTCAATGAGAT GGT. PCR amplification was carried out using Vent polymer- ase, and ... complex, the < /b> first to be identified in this domain < /b> of < /b> life. Thus, OADHCs were probably present in the < /b> common ancestor to the < /b> Bacteria and Archaea, and have be...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: The potyviral virus genome-linked protein VPg forms a ternary complex with the eukaryotic initiation factors eIF4E and eIF4G and reduces eIF4E affinity for a mRNA cap analogue ppt
... the < /b> cap analogue m 7 GDP. There are considerable discrepancies between the < /b> affinities of < /b> the < /b> cap analogue published so far. In the < /b> absence of < /b> VPg, the < /b> value of < /b> the < /b> dissociation constant obtained ... eIF4E -binding domain < /b> on eIF4G, was increased significantly by VPg. Taken together these quantitative data show that VPg is a...
Ngày tải lên: 23/03/2014, 10:21
Tài liệu Báo cáo khoa học: The unique sites in SulA protein preferentially cleaved by ATP-dependent Lon protease from Escherichia coli ppt
... than that of < /b> CcdA [3], but was scarcely degraded in t he absence ATP during 120 min of < /b> incubation. On the < /b> other hand, no degradation of < /b> MBP was observed either in the < /b> presence or in the < /b> absence of < /b> ATP ... incubation in the < /b> absence of < /b> ATP w ere also analyze d in the < /b> same way. The < /b> yields of < /b> the < /b> fragment...
Ngày tải lên: 21/02/2014, 03:20
Báo cáo khoa học: The gp130⁄STAT3 signaling pathway mediates b-adrenergic receptor-induced atrial natriuretic factor expression in cardiomyocytes ppt
... in the < /b> heart – b 1 -AR, b 2 -AR and b 3 -AR. Of < /b> these, the < /b> b 1 -AR subtype stimulates the < /b> classic Gs–adenylyl cyclase–cAMP protein < /b> kinase A < /b> signaling pathway, whereas b 2 -AR activates bifurcated signaling ... known that b- AR stimulation can activate the < /b> mitogen-activated protein < /b> kinase (MAPK) signaling pathway [15,16]. On t...
Ngày tải lên: 23/03/2014, 07:20
Tài liệu Báo cáo khóa học: The PAS fold A redefinition of the PAS domain based upon structural prediction ppt
... thaliana proteins also contain a < /b> PAC motif, and conversely that all PAC- annotated A.< /b> thaliana proteins contain a < /b> PAS domain.< /b> Therefore, in the < /b> case of < /b> A.< /b> thaliana,thePASandPAC motifs are inseparable, ... information available in public databases. This is the < /b> best possible option available, as an HMM search in PFAM did not result in the...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: The SCO2299 gene from Streptomyces coelicolor A3(2) encodes a bifunctional enzyme consisting of an RNase H domain and an acid phosphatase domain pdf
... donated by H Mori and T Baba (Institute for Advanced Biosciences, Keio University, Yamagata, Japan). Details on these strains in ASKA (a < /b> complete set of < /b> E. coli K-12 ORF archive) library are available ... Ohtani N, Yanagawa H, Tomita M & Itaya M (2004) Identification of < /b> the < /b> first archaeal type 1 RNase H gene from Halobacterium sp. NRC-1: archaeal RNase HI can cle...
Ngày tải lên: 19/02/2014, 18:20
Tài liệu Báo cáo khoa học: The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4-a-helical bundle domain docx
... PsbP and PsbQ are not functional when binding to PSII of < /b> cyano-bacteria and red algae [14]. Differences in the < /b> binding properties of < /b> green algal and higher-plant PsbP and PsbQ have also been observed ... possesses the < /b> same characteristics of < /b> the < /b> interior of < /b> the < /b> protein < /b> matrix. The < /b> script a < /b> is the < /b> peak–peak...
Ngày tải lên: 21/02/2014, 00:20
Báo cáo khoa học: The N-terminal region of the bacterial DNA polymerase PolC features a pair of domains, both distantly related to domain V of the DNA polymerase III s subunit ppt
... 2011 FEBS The < /b> N-terminal region of < /b> the < /b> bacterial DNA polymerase PolC features a < /b> pair of < /b> domains, both distantly related to domain < /b> V of < /b> the < /b> DNA polymerase III s subunit Ke˛stutis Timinskas and C ˇ eslovas ... extends an Abbreviations OB, oligonucleotide ⁄ oligosaccharide -binding; PDB, Protein < /b> Data Bank; PHP, polymerase and histi...
Ngày tải lên: 05/03/2014, 23:20