Báo cáo khoa học: The A domain of fibronectin-binding protein B of Staphylococcus aureus contains a novel fibronectin binding site pdf
Báo cáo khoa học: The transmembrane domain of subunitbof theEscherichia coli F1FOATP synthase is sufficient for H + -translocating activity together with subunitsaandc doc
... mitochondria, c hloroplasts and Bacteria. Theyreversibly catalyze the < /b> synthesis of < /b> ATP from ADP andinorganic phosphate by use of < /b> an electrochemical iongradient, which is generated across the < /b> membrane ... concentrations of < /b> FO, acsubcomplex and s ubunit b by conventional c olourimetricassays revealed to be biased by partial i mpurities of < /b> t hepreparation and by the < /b> particular buffer c omposition a < /b> ... F1.Thisdemonstrates that only the < /b> membrane part of < /b> subunit b issufficient,aswellasnecessary,forH+translocation across the < /b> m embrane, whereas the < /b> binding of < /b> F1to FOis mainlytriggered by C-terminal residues...
- 7
- 233
- 0
Tài liệu Báo cáo khoa học: The cellulosomes from Clostridium cellulolyticum Identification of new components and synergies between complexes ppt
... family of < /b> the < /b> catalytic module and the < /b> modular organization of < /b> the < /b> protein,< /b> or on the < /b> identity of < /b> the < /b> catalytic domain < /b> with another characterized protein < /b> (see text). Protein < /b> GI number a< /b> Modular ... GH5 catalytic domain < /b> shows 33% identity with a < /b> mannanase fromBacillus circulans (accession no. BAA25878.1) [31]. Protein < /b> 7b was identified as the < /b> mannanase Man2 6A< /b> [14]. Lastly, protein < /b> 13 was identified ... of < /b> the < /b> fractions analysed separately. Each of < /b> the< /b> fractions obtained by anion-exchange chromatographyshowed numerous proteins, most of < /b> which had molecu-lar masses in the < /b> range 30–160 kDa. As...
- 11
- 599
- 0
Báo cáo khoa học: The 2-oxoacid dehydrogenase multi-enzyme complex of the archaeon Thermoplasma acidophilum ) recombinant expression, assembly and characterization docx
... CCGCTCGAGTCAGATCTCGTAGATTATAGCGTTCGGE3 forward: CTACGAGAGCTAGCATGTACGATGCAATAATAATAGGTTCE3 reverse: TTTAAAAATGGAATTCAATGAGATGGT.PCR amplification was carried out using Vent polymer-ase, and ... complex, the < /b> first to be identified in this domain < /b> of < /b> life. Thus, OADHCs were probably presentin the < /b> common ancestor to the < /b> Bacteria and Archaea,and have been retained in aerobic members of < /b> each domain.< /b> ... inEscherichia coli and shown the < /b> recombinant proteinsto assemble into an a< /b> 2 b 2enzyme that catalyzes the< /b> decarboxylation of < /b> the < /b> branched-chain 2-oxoacids andpyruvate [14]. In the < /b> current paper,...
- 10
- 338
- 0
Báo cáo khoa học: The potyviral virus genome-linked protein VPg forms a ternary complex with the eukaryotic initiation factors eIF4E and eIF4G and reduces eIF4E affinity for a mRNA cap analogue ppt
... the < /b> cap analoguem7GDP. There are considerable discrepancies between the < /b> affinities of < /b> the < /b> cap analogue published so far. In the< /b> absence of < /b> VPg, the < /b> value of < /b> the < /b> dissociation constantobtained ... eIF4E -binding domain < /b> on eIF4G, was increased significantly by VPg. Taken togetherthese quantitative data show that VPg is an efficient modulator of < /b> eIF4Ebiochemical functions.AbbreviationsBN, blue ... is the < /b> firststep of < /b> a < /b> complex cascade of < /b> molecular events leadingto binding of < /b> the < /b> 40S ribosomal subunit to the < /b> mRNA[8]. The < /b> general structural similarity between the < /b> poty-virus RNA and eukaryotic...
- 11
- 489
- 0
Tài liệu Báo cáo khoa học: The unique sites in SulA protein preferentially cleaved by ATP-dependent Lon protease from Escherichia coli ppt
... thanthat of < /b> CcdA [3], but was scarcely degraded in t he absenceATP during 120 min of < /b> incubation. On the < /b> other hand, nodegradation of < /b> MBP was observed either in the < /b> presence orin the < /b> absence of < /b> ATP ... incubation in the < /b> absence of < /b> ATP w ere also analyze d in the < /b> same way. The < /b> yields of < /b> the < /b> fragments were estimated b y amino-acid analyses. The< /b> results are shown in Fig. 4. Twenty-seven cleavage sites ... such as the < /b> protea-some±ubiquitin system [21].In the < /b> absence of < /b> ATP, degradation of < /b> SulA3±169 wasextremely slow, but partial hydrolysis w as observed atTable 2. C leavage sites of < /b> SulA by Lon...
- 7
- 358
- 0
Báo cáo khoa học: The gp130⁄STAT3 signaling pathway mediates b-adrenergic receptor-induced atrial natriuretic factor expression in cardiomyocytes ppt
... in the < /b> heart – b 1-AR, b 2-AR and b 3-AR. Of < /b> these, the < /b> b 1-AR subtype stimulates the< /b> classic Gs–adenylyl cyclase–cAMP protein < /b> kinase A< /b> signaling pathway, whereas b 2-AR activates bifurcatedsignaling ... known that b- ARstimulation can activate the < /b> mitogen-activated protein< /b> kinase (MAPK) signaling pathway [15,16]. On the < /b> otherhand, the < /b> MAPK pathway has been shown to have animportant role in the < /b> ... reasons to have STAT3 in the < /b> heart. Phar-macol Ther 107, 131–137.9 Kodama H, Fukuda K, Pan J, Makino S, Sano M,Takahashi T, Hori S & Ogawa S (1998) Biphasic activa-tion of < /b> the < /b> JAK ⁄ STAT...
- 8
- 254
- 0
Tài liệu Báo cáo khóa học: The PAS fold A redefinition of the PAS domain based upon structural prediction ppt
... thaliana proteins alsocontain a < /b> PAC motif, and conversely that all PAC-annotated A.< /b> thaliana proteins contain a < /b> PAS domain.< /b> Therefore, in the < /b> case of < /b> A.< /b> thaliana,thePASandPACmotifs are inseparable, ... informationavailable in public databases. This is the < /b> best possible optionavailable, as an HMM search in PFAM did not result in the < /b> assignment of < /b> a < /b> PAC motif at the < /b> C-terminal end of< /b> many PAS domains, ... future.3Arabidopsis,Escherichia,CaenorhabditisandAzotobacter– a < /b> case studySome of < /b> the < /b> PAS domains have been analysed in detail.We chose four representative organisms from the < /b> animal,bacterial and plant kingdoms, A.< /b> thaliana,...
- 11
- 592
- 0
Tài liệu Báo cáo khoa học: The SCO2299 gene from Streptomyces coelicolor A3(2) encodes a bifunctional enzyme consisting of an RNase H domain and an acid phosphatase domain pdf
... donated by H Mori and T Baba (Institute forAdvanced Biosciences, Keio University, Yamagata, Japan).Details on these strains in ASKA (a < /b> complete set of < /b> E. coliK-12 ORF archive) library are available ... Ohtani N, Yanagawa H, Tomita M & Itaya M (2004)Identification of < /b> the < /b> first archaeal type 1 RNase H genefrom Halobacterium sp. NRC-1: archaeal RNase HI cancleave an RNA-DNA junction. Biochem ... Type 1 RNase H [19,20]. ArchaealType 1 RNase H can cleave an RNA–DNA junction (a < /b> junction between the < /b> 3¢ side of < /b> RNA and 5¢ side of< /b> DNA) of < /b> an Okazaki fragment-like substrate (RNA9–DNAÆDNA), unlike...
- 10
- 561
- 1
Tài liệu Báo cáo khoa học: The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4-a-helical bundle domain docx
... PsbP and PsbQ are not functional when binding to PSII of < /b> cyano-bacteria and red algae [14].Differences in the < /b> binding properties of < /b> green algal andhigher-plant PsbP and PsbQ have also been observed ... possesses the < /b> samecharacteristics of < /b> the < /b> interior of < /b> the < /b> protein < /b> matrix. The< /b> script a < /b> is the < /b> peak–peak distance between the < /b> maximumat %287 nm and the < /b> minimum at %283 nm, and the< /b> script b is the < /b> peak–peak ... [43], asfollows: a < /b> ¼ðrnÀ r a< /b> Þ=ðruÀ r a< /b> Þwhere rnand ruare the < /b> experimentally determinednumerical values of < /b> the < /b> ratio a/< /b> b, and r a< /b> is the < /b> theoreticalnumerical value of < /b> ratio a/< /b> b for a...
- 12
- 550
- 0
Báo cáo khoa học: The N-terminal region of the bacterial DNA polymerase PolC features a pair of domains, both distantly related to domain V of the DNA polymerase III s subunit ppt
... 2011 FEBS The < /b> N-terminal region of < /b> the < /b> bacterial DNA polymerasePolC features a < /b> pair of < /b> domains, both distantly related to domain < /b> V of < /b> the < /b> DNA polymerase III s subunitKe˛stutis Timinskas and Cˇeslovas ... extends anAbbreviationsOB, oligonucleotide ⁄ oligosaccharide -binding; PDB, Protein < /b> Data Bank; PHP, polymerase and histidinol phosphatase; RbfA, ribosome binding factor A.< /b> FEBS Journal 278 (2011) ... immediately obvious. At the < /b> same time, the < /b> established structural similarity with additionalfunctionally characterized domains (e.g. DnaA-I andRbfA) suggests that either of < /b> the < /b> two domains mightbe...
- 10
- 419
- 0
Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdflam the nao de tom tat bao cáo khoa hoctuyên tập cac bao cao khoa học hội nghị khoa học địa i apos abáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ