Tài liệu Báo cáo Y học: Dissecting the effect of trifluoroethanol on ribonuclease A Subtle structural changes detected by nonspecific proteases ppt
... differences in the changes of the tertiary and secondary structures are reflected in the activity of RNase A, its activity towards cCMP was measured as a function of the concentration of trifluoroethanol ... All other chemicals were the purest ones commercially available. Determination of RNase A concentration The protein concentration of RNase A stock solutio...
Ngày tải lên: 22/02/2014, 07:20
... primer 5¢-d(TAATGCATCCGCTTTAATTTCTGAAATTA ATG)-3¢, lower primer 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢. The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAG CATATGAAGCTTAAA AAAATTG)-3¢ ... Gly261 and Gly262. The replacement of Gly262 by Ala resulted in an inactive enzyme. Substitution of Gly261 by Ala resulted to an enzyme with lower stabilit...
Ngày tải lên: 22/02/2014, 04:20
... basically followed t he same scheme presented above for the peptide. As the program DYANA cannot handle glycopeptides it was substituted by the DG algorithm of the SYBYL software package. Again, ... does not allow easy analysis of the contribution of the carbohydrate portion. To assess the involvement of carbohydrates in antibody recognition of glycosylated structure...
Ngày tải lên: 21/02/2014, 15:20
Tài liệu Báo cáo Y học: Steady-state kinetics of the glutaminase reaction of CTP synthase from Lactococcus lactis The role of the allosteric activator GTP in coupling between glutamine hydrolysis and CTP synthesis potx
... the presence of GTP, UTP and the nonhydrolyzable ATP analog ADPNP [8]. Furthermore, it was shown that the fold activation of the glutaminase activity by GTP was similar to that of the overall CTP synthesis ... injection j)1andj,[S] syr is the concentration of the injectant in the syringe. Analysis of initial velocity data Analysis of saturation curves was perform...
Ngày tải lên: 21/02/2014, 15:20
Tài liệu Báo cáo Y học: Expression and characterization of active site mutants of hevamine, a chitinase from the rubber tree Hevea brasiliensis docx
... strand 5¢-TGAACCATGCTCTATGGCAAAATCAATACCATC-3¢ Asp125Asn Sense strand 5¢-TTGGATGGTATTGATTTTAACATAGAGCATGGTTCAACC-3¢ Anti-sense strand 5¢-GGTTGAACCATGCTCTATGTTAAAATCAATACCATCCAA-3¢ Glu127Ala Sense ... strand 5¢-GGTATTGATTTTGACATAGCGCTATGTCAAAATCAATACC-3¢ Anti-sense strand 5¢-GTACAGGGTTGAACCATGCGCTATGTCAAAATCAATACC-3¢ Asp125Ala/Glu127Ala Sense strand 5¢-GATGGTATTGATTTTGCCATAGCGCATGGTTCAACCCTG-3...
Ngày tải lên: 22/02/2014, 04:20
Tài liệu Báo cáo Y học: Presence and regulation of the endocannabinoid system in human dendritic cells potx
... were further harvested for analysis. Purification and quantification of endocannabinoids The extraction, purification and quantification of ananda- mide, 2-AG and PalEtn from immature and mature dendritic ... (B) was loaded onto the agarose gel. In (B), data are not representative of all the samples analyzed, as in only three preparations out of the six analyzed was a decrease...
Ngày tải lên: 22/02/2014, 07:20
Tài liệu Báo cáo khoa học: Seeking the determinants of the elusive functions of Sco proteins pptx
... terminal component of the respiratory chain, located in the inner mitochondrial membrane of eukaryotes and in the plasma membrane of many prokaryotes. The catalytic core of the enzyme is composed of the ... Aoyama H, Yamashita E, Tomizaki T, Yamaguchi H, Shinzawa-Itoh K, Nakashima R, Yaono R & Yoshikawa S (1995) Structures of metal sites of oxidized bovine heart...
Ngày tải lên: 14/02/2014, 18:20
Tài liệu Báo cáo khoa học: An autoinhibitory effect of the homothorax domain of Meis2 ppt
... Thus the nuclear ⁄ cytoplasmic localization of Prep1, and possibly of other Meis paralogs, may play a role in regulating transcriptional activity, but it appears that the Hth domain does not maintain ... activation by Meis2e (Fig. 1A) . How- ever, this activation by Meis2d was relatively weak, par- ticularly in light of the recent identification of a strong AD in the C-...
Ngày tải lên: 16/02/2014, 15:20
Tài liệu Báo cáo khoa học: Glucuronate, the precursor of vitamin C, is directly formed from UDP-glucuronate in liver pptx
... UDP-glucuronate and UDPGlcNAc, and the assay was initiated by addition of these two nucleotides. Where indicated, the assay was initiated by the addition of the enzyme preparation to an otherwise ... ATP-Mg was antagonized by metyra- pone, aminopyrine and chloretone (Fig. 7B,C). Further characterization of the cofactor indicated that it was retained on charcoal (Fig. 7...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: Co-operative effect of the isoforms of type III antifreeze protein expressed in Notched-fin eelpout, Zoarces elongatus Kner ppt
... isoforms of nfeAFP and ana- lyzed the thermal hysteresis (TH) activity of each as a function of pro- tein concentration. We also examined the change in activity on mixing the isoforms. TH was ... mm of nfeAFP8. These data indicate that ‘less active’ AFP isoforms can exert a substantial level of antifreeze activity after the addition of a small amount of ‘active’...
Ngày tải lên: 19/02/2014, 16:20