Tài liệu Báo cáo Y học: Differential response of neuronal cells to a fusion protein of ciliary neurotrophic factor/soluble CNTF-receptor and leukemia inhibitory factor pot

Tài liệu Báo cáo Y học: Differential response of neuronal cells to a fusion protein of ciliary neurotrophic factor/soluble CNTF-receptor and leukemia inhibitory factor pot

Tài liệu Báo cáo Y học: Differential response of neuronal cells to a fusion protein of ciliary neurotrophic factor/soluble CNTF-receptor and leukemia inhibitory factor pot

... Differential response of neuronal cells to a fusion protein of ciliary neurotrophic factor/ soluble CNTF-receptor and leukemia inhibitory factor Pia Ma¨rz 1, *, Suat O ¨ zbek 2, *, Martina Fischer 3 , ... and differentiation factor for a variety of neuronal and glial cells. It has been proposed to act as a lesion factor preventing motor...

Ngày tải lên: 22/02/2014, 07:20

9 442 0
Tài liệu Báo cáo Y học: Differential effects of arachidonoyl trifluoromethyl ketone on arachidonic acid release and lipid mediator biosynthesis by human neutrophils pot

Tài liệu Báo cáo Y học: Differential effects of arachidonoyl trifluoromethyl ketone on arachidonic acid release and lipid mediator biosynthesis by human neutrophils pot

... presented to cells, AA is incorporated into cellular glycerophospholipids by a distinct pathway. Free AA is initially converted to AA-CoA by AA-CoA synthe- tase (a) [46]. Inhibitors of AA-CoA synthetase ... choline and ethanolamine phosphoglycerides by deacylation-acylation reactions. Biochim. Biophys. Acta 326, 26–33. 51. Yamashita, A. , Sugiura, T. & Waku, K. (1997) Acyltran...

Ngày tải lên: 22/02/2014, 07:20

11 524 0
Tài liệu Báo cáo Y học: Soluble silk-like organic matrix in the nacreous layer of the bivalve Pinctada maxima A new insight in the biomineralization field pptx

Tài liệu Báo cáo Y học: Soluble silk-like organic matrix in the nacreous layer of the bivalve Pinctada maxima A new insight in the biomineralization field pptx

... WSM. Glycosaminoglycan analysis Glycosaminoglycans are highly negatively charged because of the presence of sulfate ester and/ or carboxyl groups. Therefore, they interact with cations and are precipitated ... various charac- terization methods: fractionation by size-exclusion and anion-exchange HPLC, amino acid analysis, glycosami- noglycan and calcium quantification, SDS/PAGE and...

Ngày tải lên: 21/02/2014, 01:21

10 732 0
Tài liệu Báo cáo Y học: BIGH3 (TGFBI) Arg124 mutations influence the amyloid conversion of related peptides in vitro Implications in the BIGH3-linked corneal dystrophies pptx

Tài liệu Báo cáo Y học: BIGH3 (TGFBI) Arg124 mutations influence the amyloid conversion of related peptides in vitro Implications in the BIGH3-linked corneal dystrophies pptx

... begin to appear during the first decades of life and severely impair visual acuity in adulthood. Their therapy is restricted to keratopl- asty and phototherapeutic keratectomy by Excimer laser. Unfortunately, ... [1] in granular corneal dystrophy type 2 (GCD2, Avellino dystrophy) a mixed type of amyloid and granular deposits, and Arg124Leu (R124L) [13] in corneal dystrophy o...

Ngày tải lên: 21/02/2014, 01:21

8 470 0
Tài liệu Báo cáo Y học: Interallelic complementation provides genetic evidence for the multimeric organization of the Phycomyces blakesleeanus phytoene dehydrogenase doc

Tài liệu Báo cáo Y học: Interallelic complementation provides genetic evidence for the multimeric organization of the Phycomyces blakesleeanus phytoene dehydrogenase doc

... Avda, Salamanca, Spain; 2 Centro Hispano-Luso de Investigaciones Agrarias, Universidad de Salamanca, Edi®ci o Departamental, Avda, Salamanca, Spain The Phycomyces blakesleeanus wild-type is yellow, ... mycelium and only accumulates high a mounts of phytoene [25], a nd strain S442, producing a greenish mycelium and accumulating high amounts of phytoene and small amounts of ph...

Ngày tải lên: 22/02/2014, 04:20

7 479 0
Tài liệu Báo cáo Y học: Transactivation domains are not functionally conserved between vertebrate and invertebrate serum response factors potx

Tài liệu Báo cáo Y học: Transactivation domains are not functionally conserved between vertebrate and invertebrate serum response factors potx

... 2002 TCTTATATGAATGCAGTTCTG-3¢;N3:5¢-GGGAAT TCGCTAGGCCACAGTTTGAATTTG-3¢;N4:5¢-GGG AATTCGACCTCTGAAAATGTAAAACAG-3¢;N5: 5¢-GGGAATTCGGATCCTCTAACTGGGTTAGAT-3¢; N6: 5¢-GGGAATTCGTCCCCGGACGAGGACAGG TCA-3¢;N7:5¢-GGGAATTCGCCTGCCAATGGTAAA AAGACA-3¢. TheC1deletionwasgeneratedbyPCRusingthe oligonucleotide ... [17] transcription factors. Other cofactors are regulated by growth -factor transduction pathways...

Ngày tải lên: 22/02/2014, 07:20

9 393 0
Tài liệu Báo cáo khoa học: Differential effects of Mxi1-SRa and Mxi1-SRb in Myc antagonism ppt

Tài liệu Báo cáo khoa học: Differential effects of Mxi1-SRa and Mxi1-SRb in Myc antagonism ppt

... present study, we have compared further the Mxi1-SRa and Mxi1-SRb isoforms at the levels of Myc antagonism in the REF assay, subcellular localization, and transcrip- tional activity. Some of these analyses ... that affect myc gene expression, Myc protein stability, and Myc bio- logical activity. Normal regulation of Myc activity occurs by mechanisms that influence the Myc protei...

Ngày tải lên: 18/02/2014, 16:20

11 587 0
Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt

Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt

... forward TGTGAAACGCAGTCTCTTCC H1F 122 (with H1F and H1R) 12 reverse CAAGGAGCGTTAGAATCTAAAG H1R 13 long forward TCTCCAAACCAGATCTCTACAG H2F 224 (with H2F and H2R) 14 reverse GATTTAAGTGGAGCGGAATGCTA ... (concentration and, as a consequence, total activity) of an enzyme can be chan- ged by affecting rates of transcription and ⁄ or transla- tion and ⁄ or mRNA and protein degradat...

Ngày tải lên: 19/02/2014, 02:20

11 663 0
Tài liệu Báo cáo Y học: Ligand interactions and protein conformational changes of phosphopyridoxyl-labeled Escherichia coli phosphoenol pyruvate carboxykinase determined by fluorescence spectroscopy pdf

Tài liệu Báo cáo Y học: Ligand interactions and protein conformational changes of phosphopyridoxyl-labeled Escherichia coli phosphoenol pyruvate carboxykinase determined by fluorescence spectroscopy pdf

... Chile; 2 Department of Microbiology and Immunology, University of Saskatchewan, Saskatoon, Canada Escherichia coli phosphoenolpyruvate (PEP) carboxykinase catalyzes the decarboxylation of oxaloacetate and ... decarb- oxylation of oxaloacetic acid (OAA) with the associated transfer of the c-phosphoryl group of ATP to yield PEP and ADP, where M 2+ is a divalent metal ion:...

Ngày tải lên: 21/02/2014, 01:21

9 534 0
Tài liệu Báo cáo Y học: The glucose-specific carrier of the Escherichia coli phosphotransferase system Synthesis of selective inhibitors and inactivation studies pptx

Tài liệu Báo cáo Y học: The glucose-specific carrier of the Escherichia coli phosphotransferase system Synthesis of selective inhibitors and inactivation studies pptx

... 6-O-bromoacetyl esters of methyl a- D -glucopyranoside ( 1a) andmethyla- D -manno- pyranoside (1c), methyl 6-deoxy-6-isothiocyanato -a- D - glucopyranoside (1e), b- D -glucopyranosyl isothiocyanate (3c)andb- D -glucopyranosyl ... pseudosubstrates and as reversible and irreversible inhibitors of EII Glc and EII Man . Two assays were employed: (a) nonvectorial phosphorylation of...

Ngày tải lên: 21/02/2014, 01:21

12 721 0
Từ khóa:
w