Tài liệu Báo cáo khoa học: "Human Evaluation of a German Surface Realisation Ranker" docx
Tài liệu Báo cáo khoa học: "Human Evaluation of a German Surface Realisation Ranker" docx
... ForstPalo Alto Research Center3333 Coyote Hill RoadPalo Alto, CA 94304, USAmforst@parc.comAbstractIn this paper we present a human-based evaluation of surface realisation alterna-tives. ... but there arealso clearly factors that make certain real-isation alternatives more natural.1 IntroductionAn important component of research on surface realisation (the task of generating strings ... evaluation of realisation rankers would rank alternative real-isations in the same way as native speakers of thelanguage for which the surface realisation systemis developed, and not only globally,...
- 9
- 479
- 0
Tài liệu Báo cáo khoa học: Human Cdc45 is a proliferation-associated antigen pdf
... 29,577–580.Supplementary materialThe following supplementary material is availableonline:Fig. S1. Regulation of human Cdc45 protein duringterminal differentiation.This material is available as part of the ... immunoreactivity of a Cdc45-specific antibody on formalin-fixed andparaffin-embedded tissues (Fig. 9). Antibodies againstPCNA and Cdc45 stained malignant cells in a compar-able manner, e.g. on invasive-lobular ... (HRP) (allDianova, Hamburg, Germany) and goat anti-(mouse ⁄ rab-bit IgG) conjugated HRP ⁄ alkaline phosphatase (Promega,Madison, WI).Cell culture and synchronizationCell lines were purchased...
- 16
- 504
- 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCCpYESTrp2 ⁄ PDIP46⁄ SKAR(F) GCGGGATCCCTGGACGGGCAGCCGATGAAGATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGTpYESTrp2 ⁄ PDIP46 ⁄ SKAR(G) ... SKAR(b) AAACTGCAGGATGGCGGACATCTCCCTGGACAAACTGCAGAAGCTTGATTTTGAATTCTGTpEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCCGCGGGATCCCGGATGCTGGCAGCGTGGGTTGGpYESTrp2 ⁄ PDIP46 ⁄ SKAR (A) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTTpYESTrp2 ... GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGpEGFP-N1 ⁄ ER GCGAAGCTTCACGATGTCTCACACCATTTGCGGGATCCCGTTTCCCAGCCTGTTGGGCCTpEGFP-N1 ⁄ PDIP46(1) ⁄ SKAR (a) AAACTGCAGGATGGCGGACATCTCCCTGGACAAACTGCAGAAGCTTGATTTTGAATTCTGTpEGFP-N1...
- 14
- 517
- 0
Tài liệu Báo cáo khoa học: "Automatic Evaluation of Sentence-Level Fluency Andrew Mutton∗" pdf
... 2109 Australia NSW 2109 Australiamadras@ics.mq.edu.auAbstractIn evaluating the output of language tech-nology applications—MT, natural languagegeneration, summarisation—automatic eval-uation ... summary, and a language model. Evaluation methods can be said to fall into two cate-gories: a comparison to gold reference, or an appealto human judgements. Automatic evaluation meth-ods carrying ... specificcharacteristics of good text.In terms of automatic evaluation, we are not aware of any technique that measures only fluency or sim-ilar characteristics, ignoring content, apart from that of Wan...
- 8
- 507
- 0
Tài liệu Báo cáo khoa học: "Automatic Evaluation of Machine Translation Quality Using Longest Common Subsequence and Skip-Bigram Statistics" doc
... the evaluations of ROUGE-L, ROUGE-S, and compare their per-formance with other automatic evaluation meas-ures. 5 Evaluations One of the goals of developing automatic evalua-tion measures ... simi-larity between a candidate translation and a set of reference translations with a numerical metric. They used a weighted average of variable length n-gram matches between system translations ... large-scale machine translation evalua-tions. Recently, Turian et al. (2003) indicated that standard accuracy measures such as recall, preci-sion, and the F-measure can also be used in evalua-tion...
- 8
- 442
- 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... Structure and function of a regulated archaealtriosephosphate isomerase adapted to high temperature.J Mol Biol 342, 861–875.12 Gayathri P, Banerjee M, Vijayalakshmi A, Azeez S,Balaram H, Balaram ... mutationsMousumi Banerjee1, Hemalatha Balaram2and Padmanabhan Balaram11 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India2 Molecular Biology and Genetics Unit, Jawaharlal ... inenzymes: a study of triosephosphate isomerase andcomparison with methyl glyoxalsynthase. Adv ProteinChem 66, 315–372.45 Gunasekaran K, Ramakrishnan C & Balaram P (1996)Disallowed Ramachandran...
- 15
- 635
- 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf
... M, Hasegawa K, HoritaC & Akera S (1999) A new matrix protein familyrelated to the nacreous layer formation of Pinctadafucata. FEBS Lett 462, 225–229.5 Kono M, Hayashi N & Samata T ... structure–functionrelationship analysis of Prismalin–14 from the prismaticlayer of the Japanese pearl oyster, Pinctada fucata.FEBS J 274, 5158–5166.9 Murayama E, Takagi Y, Ohira T, Davis JG, GreeneMI & Nagasawa H ... byinvertebrates, and has three crystal phases: calcite, ara-gonite and vaterite. Although calcite is the most stablecrystal thermodynamically, many organisms can formmetastable aragonite crystals...
- 12
- 568
- 0
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx
... absorption bands. Heme catabolism byHOs of mammals, pathogenic bacteria, cyanobacteriaand probably insects is considered to have a similarmechanism, because the characteristic absorptionbands of verdoheme ... T, Zhang X, Sun D,Sato M, Sasahara M, Kayama T, Ikeda-Saito M &Yoshida T (2000) Histidine 20, the crucial proximalaxial heme ligand of bacterial heme oxygenase Hmu Ofrom Corynebacterium ... Then, a broad bandappeared at around 660 nm, and was maximal 9–12 minafter initiation of the reaction. The spectral features of the final reaction mixture were analogous, but not iden-tical,...
- 16
- 617
- 0
Tài liệu Báo cáo khoa học: Crystal structures of a bacterial 6-phosphogluconate dehydrogenase reveal aspects of specificity, mechanism and mode of inhibition by analogues of high-energy reaction intermediates pdf
... 25% of the accessible surface area of a monomer contributes to LlPDHdimer formation. Whereas LlPDH and OaPDH have a buried surface area of 5500 A ˚2, TbPDH has a largerinterface surface area ... suite: programs for protein crystallo-graphy.Acta Crystallogr D Biol Crystallogr 50, 760–763.28 Navaza J (1994) Amore – an automated package formolecular replacement. Acta Crystallogr A 50, 157–163.29 ... smaller compound PEA(Fig. 1B) and a water molecule are present and PEXand PEA refined satisfactorily with occupancies of 0.7Table 1. Data and refinement statistics. Values in parentheses pertain...
- 12
- 452
- 0
Tài liệu Báo cáo khóa học: New activities of a catalytic antibody with a peroxidase activity ppt
... antibodies with a metalloporphyrin cofactor, orÔhemoabzymesÕ, are not as efficient a category of catalysts astheir natural hemoprotein counterparts. The hemoabzymes,which display a peroxidase ... (MP8), a heme octapeptidewhere the imidazole side-chain of histidine 18 acts as a proximal ligand of the iron atom. A set of six monoclonalantibodies was thus obtained: the best peroxidase activity ... spectrometry.Preparation of monoclonal antibodiesMP8 was covalently attached to keyhole limpet hemo-cyanin (KLH) and to BSA, using glutaraldehyde as a coupling agent, in 1Mbicarbonate buffer, pH 9.5, accordingto...
- 7
- 447
- 0
Từ khóa: Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI