Tài liệu Báo cáo Y học: Caged O2 Reaction of cytochrome bo3 oxidase with photochemically released dioxygen from a cobalt peroxo complex doc

... Caged O 2 Reaction of cytochrome bo 3 oxidase with photochemically released dioxygen from a cobalt peroxo complex Claudia Ludovici, Roland Fro¨ hlich*, Karsten Vogtt, Bjo¨ rn Mamat† and Mathias ... Tsukihara, T., Aoyama, H., Yamashita, E., Tomizaki, T., Yamaguchi, H., Shinzawa-Itoh, K., Nakashima, R., Yaono, R. & Yoshikawa, S. (1995) Structures of metal site...

Ngày tải lên: 21/02/2014, 15:20

... Hamming distance was calculated instead of the mutual information. The reductive unfolding kinetics was analyzed by a linear expansion least-squares algorithm and graphically using a least mean ... especially at relatively high temperatures [20], of the protein are usually dominated by a major pathway related to a major rate-determining intermediate in similar redox systems. For...

Ngày tải lên: 21/02/2014, 01:21

... strongly to a MUC-1 that has only part of its carbohydrate chains removed [10]. It was later shown on a molecular level that a small oligosaccharide attached t o Thr3 enhances binding affinity of glycopeptides ... data analysis. Solute e xchange w as achieved by ultrafiltration of the 156-kDa SM3 antibody with a Centricon (Millipore) membrane having a cutoff value of 50 kDa....

Ngày tải lên: 21/02/2014, 15:20

... University of Copenhagen, Copenhagen, Denmark CTP synthase catalyzes the reaction glutamine + UTP +ATP fi glutamate + CTP + ADP + P i .Therate of the reaction is greatly enhanced by the allosteric activator GTP. ... explanation may be that 4-phosphorylated UTP by itself acts as a weak activator of glutamine hydrolysis. This activation is greatly enhanced by GTP binding to the enzym...

Ngày tải lên: 21/02/2014, 15:20

... 5¢-TGAACCATGCTCTATGGCAAAATCAATACCATC-3¢ Asp125Asn Sense strand 5¢-TTGGATGGTATTGATTTTAACATAGAGCATGGTTCAACC-3¢ Anti-sense strand 5¢-GGTTGAACCATGCTCTATGTTAAAATCAATACCATCCAA-3¢ Glu127Ala Sense strand 5¢-GGTATTGATTTTGACATAGCGCTATGTCAAAATCAATACC-3¢ Anti-sense ... 5¢-CAGGGTTGAACCATGCGCTATGGCAAAATCAATACCATC-3¢ Tyr183Phe Sense strand 5¢-TATGTATGGGTTCAATTCTTTAACAATCCACCATGCCAG-3¢ Anti-sense strand 5¢-C...

Ngày tải lên: 22/02/2014, 04:20

... primer 5¢-d(TATTTGCATGGCC AGCCCAATCTATTTGAG)-3¢; Gly262 to Ala, upper primer 5¢-d(ATAGATTGGGGTGCCCATGCAAATAA TGCA)-3¢, lower primer 5¢-d(ATTATTTGCATGGGCA CCCCAATCTATTTG)-3¢; Tyr269 to Ala, upper ... primer 5¢-d(TAATGCATCCGCTTTAATTTCTGAAATTA ATG)-3¢, lower primer 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢. The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAG CA...

Ngày tải lên: 22/02/2014, 04:20

... pattern raises the possibility that Ca 2+ may have a dual mechanism of action in activating PtdEtn-PLD, e.g. Ca 2+ may participate in catalysis as well as facilitate enzyme– substrate interaction. ... preferentially hydrolyses phosphatidyl- ethanolamine (PtdEtn) and phosphatidylserine and does not catalyse a transphosphatidylation with primary short-chain alcohols. We have characteriz...

Ngày tải lên: 22/02/2014, 07:20

... 8675093, E-mail: vdimarzo@icmib.na.cnr.it Abbreviations: 2-AG, 2-arachidonoylglycerol; PalEtn, N-palmitoyl- ethanolamine; FAAH, fatty acid amide hydrolase; THC, D 9 -tetra- hydrocannabinol; LPS, lipopolysaccharide; ... anandamide and 2-arachidonoylglycerol (2-AG), the cannabinoid CB 1 and CB 2 receptors, and one of the enzymes mostly responsible for endocannabinoid hydrolysis, the fatty aci...

Ngày tải lên: 22/02/2014, 07:20

... the average of three independent measurements ± SD. Proteinase K activity assay Proteinase K activity was determined at 25 °Cwith N-succinyl-Ala-Ala-Ala-p-nitroanilide as substrate [26]. Assay mixtures ... Trifluoroethanol and cytidine 2¢:3¢-cyclic monophos- phate (cCMP) were from Fluka, phenylmethanesulfonyl fluoride was from Merck, and N-succinyl-Ala-Ala-Ala- p-nitroanilide from Bache...

Ngày tải lên: 22/02/2014, 07:20

... the case of inhibins, which also belong to the TGFb superfamily, the pro-domains appear to play a role in assembly and secretion [13]. Similarly, an inhib- itory role of the non-covalently attached ... Association and dissociation rate constants were obtained from 7–9 analyte concentrations. Mean values with a standard deviation were deduced from five indepen- dent measurements....

Ngày tải lên: 18/02/2014, 06:20