Tài liệu Báo cáo Y học: Caged O2 Reaction of cytochrome bo3 oxidase with photochemically released dioxygen from a cobalt peroxo complex doc

... Caged O2 Reaction of cytochrome bo3 oxidase with photochemically released dioxygen from a cobalt peroxo complex Claudia Ludovici, Roland Fro¨ hlich*, Karsten Vogtt, Bjo¨ rn Mamat† and Mathias ... Tsukihara, T., Aoyama, H., Yamashita, E., Tomizaki, T., Yamaguchi, H., Shinzawa-Itoh, K., Nakashima, R., Yaono, R. &Yoshikawa, S. (1995) Structures of metal sites of oxidized bovineheart cytochrome ... cytochrome c oxidase at 2.8 A ˚. Science 269, 1069–1074.9. Tsukihara, T., Aoyama, H., Yamashita, E., Tomizaki, T., Yamaguchi, H., Shinzawa-Itoh, K., Nakashima, R., Yaono, R. &Yoshikawa, S. (1996)...

Tài liệu Báo cáo Y học: Biphasic reductive unfolding of ribonuclease A is temperature dependent pdf

... Hammingdistance was calculated instead of the mutual information.The reductive unfolding kinetics was analyzed by a linearexpansion least-squares algorithm and graphically using a least mean ... especially at relatively high temperatures[20], of the protein are usually dominated by a majorpathway related to a major rate-determining intermediate insimilar redox systems. For a single pathway, ... C., Narayan, M., Wedemeyer, W.J. &Scheraga, H .A. (2000) Acceleration of oxidative folding of bovinepancreatic ribonuclease A by anion-induced stabilization andformation of structured native-like...

Tài liệu Báo cáo Y học: NMR-based determination of the binding epitope and conformational analysis of MUC-1 glycopeptides and peptides bound to the breast cancer-selective monoclonal antibody SM3 pptx

... strongly to a MUC-1that has only part of its carbohydrate chains removed [10].It was later shown on a molecular level that a smalloligosaccharide attached t o Thr3 enhances binding afﬁnity of glycopeptides ... data analysis.Solute e xchange w as achieved by ultraﬁltration of the156-kDa SM3 antibody with a Centricon (Millipore)membrane having a cutoff value of 50 kDa.Fig. 1. Pentapeptide and glycopentapeptide ... experiments was set to  0.15 W. Selective presat-uration of the protein was achieved by a train of 40Gaussian shaped pulses of 50 ms length, each separated by a 1 ms delay, leading to a total saturation...

Tài liệu Báo cáo Y học: Steady-state kinetics of the glutaminase reaction of CTP synthase from Lactococcus lactis The role of the allosteric activator GTP in coupling between glutamine hydrolysis and CTP synthesis potx

... University of Copenhagen, Copenhagen, DenmarkCTP synthase catalyzes the reaction glutamine + UTP+ATP ﬁ glutamate + CTP + ADP + Pi.Therate of the reaction is greatly enhanced by the allosteric activatorGTP. ... explanation may be that 4-phosphorylated UTPby itself acts as a weak activator of glutamine hydrolysis.This activation is greatly enhanced by GTP binding to theenzyme. From Table 2 it can be ... hydrolysisAs was already indicated by the results in Table 1 anddiscussed above, the kinetics of GTP activation of theglutaminase half -reaction differed markedly on whetherthe reaction was...

Tài liệu Báo cáo Y học: Expression and characterization of active site mutants of hevamine, a chitinase from the rubber tree Hevea brasiliensis docx

... 5¢-TGAACCATGCTCTATGGCAAAATCAATACCATC-3¢Asp125Asn Sense strand 5¢-TTGGATGGTATTGATTTTAACATAGAGCATGGTTCAACC-3¢Anti-sense strand 5¢-GGTTGAACCATGCTCTATGTTAAAATCAATACCATCCAA-3¢Glu127Ala Sense strand 5¢-GGTATTGATTTTGACATAGCGCTATGTCAAAATCAATACC-3¢Anti-sense ... 5¢-CAGGGTTGAACCATGCGCTATGGCAAAATCAATACCATC-3¢Tyr183Phe Sense strand 5¢-TATGTATGGGTTCAATTCTTTAACAATCCACCATGCCAG-3¢Anti-sense strand 5¢-CTGGCATGGTGGATTGTTAAAGAATTGAACCCATACATA-3¢Asp125Ala/Tyr183Phe This mutant was ... 5¢-GGTATTGATTTTGACATAGCGCTATGTCAAAATCAATACC-3¢Anti-sense strand 5¢-GTACAGGGTTGAACCATGCGCTATGTCAAAATCAATACC-3¢Asp125Ala/Glu127Ala Sense strand 5¢-GATGGTATTGATTTTGCCATAGCGCATGGTTCAACCCTG-3¢Anti-sense strand 5¢-CAGGGTTGAACCATGCGCTATGGCAAAATCAATACCATC-3¢Tyr183Phe...

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

... primer 5¢-d(TATTTGCATGGCCAGCCCAATCTATTTGAG)-3¢; Gly262 to Ala, upperprimer 5¢-d(ATAGATTGGGGTGCCCATGCAAATAATGCA)-3¢, lower primer 5¢-d(ATTATTTGCATGGGCACCCCAATCTATTTG)-3¢; Tyr269 to Ala, upper ... primer5¢-d(TAATGCATCCGCTTTAATTTCTGAAATTAATG)-3¢, lower primer 5¢-d(TCAGAAATTAAAGCGGATGCATTATTTGCATG)-3¢.The upstream primer containing the NdeI restriction site(underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAAAAAATTG)-3¢ ... wereresidues Gly261 and Gly262. The replacement of Gly262 byAla resulted in an inactive enzyme. Substitution of Gly261by Ala resulted to an enzyme with lower stability andincreased energy of activation....

Tài liệu Báo cáo Y học: Characterization and regulation of yeast Ca2+-dependent phosphatidylethanolamine-phospholipase D activity docx

... pattern raises the possibility that Ca2+may have a dualmechanism of action in activating PtdEtn-PLD, e.g. Ca2+may participate in catalysis as well as facilitate enzyme–substrate interaction. ... preferentially hydrolyses phosphatidyl-ethanolamine (PtdEtn) and phosphatidylserine and does notcatalyse a transphosphatidylation with primary short-chainalcohols. We have characterized the cytosolic ... 2002Characterization and regulation of yeast Ca2+-dependentphosphatidylethanolamine-phospholipase D activityXiaoqing Tang, Michal Waksman, Yona Ely and Mordechai LiscovitchDepartment of Biological...

Tài liệu Báo cáo Y học: Presence and regulation of the endocannabinoid system in human dendritic cells potx

... 8675093,E-mail: vdimarzo@icmib.na.cnr.itAbbreviations: 2-AG, 2-arachidonoylglycerol; PalEtn, N-palmitoyl-ethanolamine; FAAH, fatty acid amide hydrolase; THC, D9-tetra-hydrocannabinol; LPS, lipopolysaccharide; ... anandamideand 2-arachidonoylglycerol (2-AG), the cannabinoid CB1and CB2receptors, and one of the enzymes mostlyresponsible for endocannabinoid hydrolysis, the fatty acidamide hydrolase (FAAH). ... allergen, Der p 1.MATERIALS AND METHODSMaterials and animalsDeuterated anandamide, PalEtn and 2-AG were synthe-sized from [2H4]palmitic acid and [2H8]arachidonic acidand ethanolamine...

Tài liệu Báo cáo Y học: Dissecting the effect of triﬂuoroethanol on ribonuclease A Subtle structural changes detected by nonspeciﬁc proteases ppt

... theaverage of three independent measurements ± SD.Proteinase K activity assayProteinase K activity was determined at 25 °CwithN-succinyl-Ala-Ala-Ala-p-nitroanilide as substrate [26].Assay mixtures ... Triﬂuoroethanol and cytidine 2¢:3¢-cyclic monophos-phate (cCMP) were from Fluka, phenylmethanesulfonylﬂuoride was from Merck, and N-succinyl-Ala-Ala-Ala-p-nitroanilide from Bachem. All other chemicals ... a function of the concentration of triﬂuoroethanol. Activity of proteinase K was determined with N-succinyl-Ala-Ala-Ala-p-nitroanilide as substrate at 25 °Casdescribed in Materials and methods.3832...

Tài liệu Báo cáo khoa học: The pro-form of BMP-2 interferes with BMP-2 signalling by competing with BMP-2 for IA receptor binding pptx

... the case of inhibins, which also belong to theTGFb superfamily, the pro-domains appear to play a role in assembly and secretion [13]. Similarly, an inhib-itory role of the non-covalently attached ... Association and dissociation rate constantswere obtained from 7–9 analyte concentrations. Mean values with a standard deviation were deduced from ﬁve indepen-dent measurements. Apparent dissociation ... activity and muscle growth. Proc Natl Acad SciUSA98, 9306–9311.17 Brown MA, Zhao Q, Baker KA, Naik C, Chen C,Pukac L, Singh M, Tsareva T, Parice Y, Mahoney A et al. (2005) Crystal structure of...

Xem thêm

Từ khóa: tài liệu báo cáo nghiên cứu khoa học báo cáo y học tài liệu báo cáo tài liệu báo cáo môn triết tài liệu báo cáo tài chính tài liệu di truyền y học Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui ro Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ