Tài liệu Báo cáo Y học: A family of expressed antifreeze pro

Tài liệu Báo cáo Y học: A family of expressed antifreeze protein genes from the moth, Choristoneura fumiferana ppt

... concentration of the cryoprotectant, glycerol, 10-fold and desiccate to 40% of the prediapause water content [4]. Taken together, these adaptations may explain the impressive ability of C. fumiferana ... A family of expressed antifreeze protein genes from the moth, Choristoneura fumiferana Daniel Doucet, Michael G. Tyshenko, Peter L. Davies and Virginia K...

Ngày tải lên : 21/02/2014, 15:20

9
422
0

Tài liệu Báo cáo Y học: A novel, inducible, citral lyase puriﬁed from spores of Penicillium digitatum docx

... reaction the actions of a hydratase and an aldolase are needed. Citral lyase of P. digitatum combines hydratase and aldolase activity in a single enzyme. No other enzyme has been reported to catalyse ... shown). Substrate speciﬁcity Arangeofa,b-unsaturated aldehydes were tested as substrates for citral lyase (Table 2). As the total activity of the partially puriﬁed citral lyas...

Ngày tải lên : 21/02/2014, 01:21

8
575
0

Tài liệu Báo cáo Y học: A pool of Y2 neuropeptide Y receptors activated by modiﬁers of membrane sulfhydryl or cholesterol balance pot

... little accumulation due to receptor externalization The dynamics of appearance of additional surface sites at 30 l M PAO indicated a fast activation, as the increase in the labeling by agonist ... selectivity and the economy of action. Scavenging by cell membrane- resident ectoproteinases by way of in situ encounters with extra- cellular agonists may not satisfy the cleara...

Ngày tải lên : 22/02/2014, 04:20

8
469
1

Tài liệu Báo cáo Y học: Divergent members of a soybean (Glycine max L.) 4-coumarate:coenzyme A ligase gene family potx

... details of the catalytic capacity of the isoforms as well as of the d ifferential regulation of t he isozymes in re lation to specialized branc hes of phenylpro- panoid metabolism. Molecular analysis ... and the dynamics of their synthesis. In any case, the coordinated r egulation of 4 CL3 or 4 with a ll other known enzymes of phytoalexin biosynthesis in soybean...

Ngày tải lên : 22/02/2014, 04:20

12
448
0

Tài liệu Báo cáo Y học: Identiﬁcation of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf

... suggest that certain enzymes, and therefore the corresponding genes of the A2 0 1A biosynthetic pathway, may be related to their counterparts of the puromycin and hygromycin A biosynthetic pathways, respectively. The ... similarities with several products from the pur cluster of S. alboniger [6]. They were accordingly named ataP3, ataP5, ataP4, ataP10 and ataP7. The...

Ngày tải lên : 21/02/2014, 01:21

9
728
0

Tài liệu Báo cáo Y học: A novel meta-cleavage dioxygenase that cleaves a carboxyl-groupsubstituted 2-aminophenol Puriﬁcation and characterization of 4-amino-3-hydroxybenzoate 2,3-dioxygenase from Bordetella sp. strain 10d doc

... m M Fe(NH 4 ) 2 (SO 4 ) 2 slightly increased the activity. Other metal salts did not affect the enzyme activity. Fig. 3. Absorption spectra of the reaction products from the cleavage of 4-amino-3-hydroxybenzoate. (A) Reaction ... Murakami, S., Nakanishi, Y. , Kodama, N., Takenaka, S., Shinke, R. & Aoki, K. (1998) Puriﬁcation, characterization, and gene analysis of catecho...

Ngày tải lên : 21/02/2014, 01:21

7
490
0

Tài liệu Báo cáo Y học: A Raman optical activity study of rheomorphism in caseins, synucleins and tau New insight into the structure and behaviour of natively unfolded proteins pot

... amyloid disease [22]. MATERIALS AND METHODS Materials The b-casein w as prepared from whole a cid casein b y the urea fractionation method of Aschaffenburg [35]. The j-casein was prepared by adaptation of ... were also attempted on a S1 -and a S2 -casein, these proteins had a tendency to aggregate in the laser beam, which prevented the acquisition of ROA data of...

Ngày tải lên : 21/02/2014, 15:20

9
667
0

Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

... franciscana Oligomerization and thermotolerance Julie A. Crack, Marc Mansour, Yu Sun and Thomas H. MacRae Department of Biology, Dalhousie University, Halifax, Nova Scotia, Canada Oviparously ... CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT p26-CD10 183–192 (p26-1Bam-s) GCGCGGATCCACCATGGCACTTAACCCATG 546/182 (P26-182 Xho-as) CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT p26-alpha 1–60 and (p26-60Bam-s) GCGCGGATCCA...

Ngày tải lên : 22/02/2014, 04:20

10
495
0

Tài liệu Báo cáo Y học: Differential response of neuronal cells to a fusion protein of ciliary neurotrophic factor/soluble CNTF-receptor and leukemia inhibitory factor pot

... likely mediated by activation of the MAPK pathway and that this response is substantially independent of the JAK/STAT pathway. DISCUSSION We have successfully expressed an active fusion protein of human ... were analyzed by SDS/PAGE [31] and visual- ized by fluorography using the fluorographic intensifier solution ÔAmplifyÕ (Amersham International, Aylesbury, UK). Proliferation a...

Ngày tải lên : 22/02/2014, 07:20

9
442
0

Tài liệu Báo cáo khoa học: A role of miR-27 in the regulation of adipogenesis ppt

... Total RNA was prepared from epididymal fat pads harvested from ob ⁄ ob mice and genetically matched lean mice. Levels of miRNA expres- sion were analyzed by TaqMan quantitative PCR. Data are mean value ... treated as described in (A) . Total RNA was prepared at the indicated times and subjected to quantitative real-time PCR analysis. The data shown are mean value ± standard errors...

Ngày tải lên : 18/02/2014, 08:20

11
848
0