Tài liệu Báo cáo Y học: Biphasic reductive unfolding of ribonuclease A is temperature dependent pdf

... Hammingdistance was calculated instead of the mutual information.The reductive unfolding kinetics was analyzed by a linearexpansion least-squares algorithm and graphically using a least mean ... analysis,which is established by us recently [4,11], was used toanalyze the unfolding dynamics and also was introducedinto the analysis of the thermal transition study by CD and1HNMR.MATERIALS AND ... experiments.The data analysis was carried out by spectral imageanalysis method established recently [4,11]. The spectrumparameters (Shannon entropy, H; Mutual Shannon Infor-mation, MI and Correlation...

Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is speciﬁcally induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

... b-1,4-Endogalactanases cleavewithin the galactan moiety of type I arabinogalactan,releasingD-galacto-oligosaccharides. Bacterial b-1,4-endo-galactanases release mainly galactotriose and galactotetra-ose ... soy arabinogalactan consists of 57%D-galactose and 38%L-arabinose. Methylation analysisdemonstrated that a substantial amount of theL-arabinoseresidues (14%) in soy arabinogalactan is ... detected against any of the transgalactooligosaccharides listed in Materials andmethods.Hydrolysis of arabinogalactansThe sugar composition of the arabinogalactans frompotato, onion and soy was...

Tài liệu Báo cáo Y học: NMR-based determination of the binding epitope and conformational analysis of MUC-1 glycopeptides and peptides bound to the breast cancer-selective monoclonal antibody SM3 pptx

... Thr3 enhances binding afﬁnity of glycopeptides to the antibody [18].Conventional pepscan analysis however, does not alloweasy analysis of the contribution of the carbohydrateportion. To assess ... GalNAc residue of PDT(O -a- D-GalNAc)RP receive overall less saturationthan each of the amino acids. Only the N-acetyl methylgroup has a strong STD NMR signal. It is very unlikely thatthis ... Subtraction of the 1D STD spectra wasperformed internally via phase cycling after every scan tominimize temperature and magnet instability artefacts.The so called on resonance irradiation of...

Tài liệu Báo cáo Y học: Caged O2 Reaction of cytochrome bo3 oxidase with photochemically released dioxygen from a cobalt peroxo complex doc

... Tsukihara, T., Aoyama, H., Yamashita, E., Tomizaki, T., Yamaguchi, H., Shinzawa-Itoh, K., Nakashima, R., Yaono, R. &Yoshikawa, S. (1995) Structures of metal sites of oxidized bovineheart cytochrome ... cytochrome c oxidase at 2.8 A ˚. Science 269, 1069–1074.9. Tsukihara, T., Aoyama, H., Yamashita, E., Tomizaki, T., Yamaguchi, H., Shinzawa-Itoh, K., Nakashima, R., Yaono, R. &Yoshikawa, S. (1996) ... oxidase. They allow the prediction of twodifferent proton-translocating channels, called the K- andD-channels. The D-channel contains an array of charged orpolar amino acids, and is located...

Tài liệu Báo cáo Y học: Steady-state kinetics of the glutaminase reaction of CTP synthase from Lactococcus lactis The role of the allosteric activator GTP in coupling between glutamine hydrolysis and CTP synthesis potx

... lactis enzyme, a plausible explanation may be that 4-phosphorylated UTPby itself acts as a weak activator of glutamine hydrolysis.This activation is greatly enhanced by GTP binding to theenzyme.From ... velocity data from the activation of CTP synthesis or glutaminase activity by GTP as measuredspectrophotometrically was analysed usingv ¼ kcat;1½Eþkcat;2½E A K A þ A ð6Þwhere kcat,1and ... 1A shows the raw calorimetric data (enthalpo-gram) obtained for glutamine hydrolysis by CTP synthase.The complete hydrolysis of glutamine necessary for calcu-lating the molar enthalpy DH, and...

Tài liệu Báo cáo Y học: Expression and characterization of active site mutants of hevamine, a chitinase from the rubber tree Hevea brasiliensis docx

... strand 5¢-TGAACCATGCTCTATGGCAAAATCAATACCATC-3¢Asp125Asn Sense strand 5¢-TTGGATGGTATTGATTTTAACATAGAGCATGGTTCAACC-3¢Anti-sense strand 5¢-GGTTGAACCATGCTCTATGTTAAAATCAATACCATCCAA-3¢Glu127Ala Sense ... strand 5¢-GGTATTGATTTTGACATAGCGCTATGTCAAAATCAATACC-3¢Anti-sense strand 5¢-GTACAGGGTTGAACCATGCGCTATGTCAAAATCAATACC-3¢Asp125Ala/Glu127Ala Sense strand 5¢-GATGGTATTGATTTTGCCATAGCGCATGGTTCAACCCTG-3¢Anti-sense ... 5¢-GATGGTATTGATTTTGCCATAGCGCATGGTTCAACCCTG-3¢Anti-sense strand 5¢-CAGGGTTGAACCATGCGCTATGGCAAAATCAATACCATC-3¢Tyr183Phe Sense strand 5¢-TATGTATGGGTTCAATTCTTTAACAATCCACCATGCCAG-3¢Anti-sense strand 5¢-CTGGCATGGTGGATTGTTAAAGAATTGAACCCATACATA-3¢Asp125Ala/Tyr183Phe...

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

... primer 5¢-d(TATTTGCATGGCCAGCCCAATCTATTTGAG)-3¢; Gly262 to Ala, upperprimer 5¢-d(ATAGATTGGGGTGCCCATGCAAATAATGCA)-3¢, lower primer 5¢-d(ATTATTTGCATGGGCACCCCAATCTATTTG)-3¢; Tyr269 to Ala, upper ... role of a glycine cluster in cold adaptation of an alkaline phosphataseKonstantinos Mavromatis1,*, Iason Tsigos2,*, Maria Tzanodaskalaki2, Michael Kokkinidis1,3and Vassilis Bouriotis1,21Department ... primer5¢-d(TAATGCATCCGCTTTAATTTCTGAAATTAATG)-3¢, lower primer 5¢-d(TCAGAAATTAAAGCGGATGCATTATTTGCATG)-3¢.The upstream primer containing the NdeI restriction site(underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAAAAAATTG)-3¢...

Tài liệu Báo cáo Y học: Granule-bound starch synthase I A major enzyme involved in the biogenesis of B-crystallites in starch granules ppt

... course of storage starch synthesis show that amylopectin and amylosesynthesis are partly disconnected and that amylose synthesispersists when the rate of polysaccharide and amylopectinsynthesis ... further and the rate of amylosesynthesis accounts for most polysaccharide synthesis. Atthis stage the rate of amylopectin synthesis has becomeminimal and it is difﬁcult to say if the residualamylopectin ... kinetics of amylose synthesis over a 5-day period of nitrogen starvation and measured theamounts of starch, amylose, the kmax of the starchfractions, the degree of crystallinity and the X-rayFig....

Tài liệu Báo cáo Y học: Characterization and regulation of yeast Ca2+-dependent phosphatidylethanolamine-phospholipase D activity docx

... 2002Characterization and regulation of yeast Ca2+ -dependent phosphatidylethanolamine-phospholipase D activityXiaoqing Tang, Michal Waksman, Yona Ely and Mordechai LiscovitchDepartment of Biological ... cellular localization.The stimulation of PtdEtn-PLD by Ca2+ions is biphasic. This pattern raises the possibility that Ca2+may have a dualmechanism of action in activating PtdEtn-PLD, e.g. Ca2+may ... preferentially hydrolyses phosphatidyl-ethanolamine (PtdEtn) and phosphatidylserine and does notcatalyse a transphosphatidylation with primary short-chainalcohols. We have characterized the cytosolic...

Tài liệu Báo cáo Y học: Presence and regulation of the endocannabinoid system in human dendritic cells potx

... 8675093,E-mail: vdimarzo@icmib.na.cnr.itAbbreviations: 2-AG, 2-arachidonoylglycerol; PalEtn, N-palmitoyl-ethanolamine; FAAH, fatty acid amide hydrolase; THC, D9-tetra-hydrocannabinol; LPS, lipopolysaccharide; ... anandamideand 2-arachidonoylglycerol (2-AG), the cannabinoid CB1and CB2receptors, and one of the enzymes mostlyresponsible for endocannabinoid hydrolysis, the fatty acidamide hydrolase (FAAH). ... of endocannabinoids are expressed as pmols or nmols per 107cells extracted. Data were statistically evaluated byANOVA(Bonferroni-adjusted).Total RNA isolation and RT-PCR analysisTotal RNA from...

Xem thêm

Từ khóa: Báo cáo y học tài liệu báo cáo tài liệu báo cáo môn triết tài liệu báo cáo tài chính tài liệu báo cáo nghiên cứu khoa học Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015