Tài liệu Báo cáo Y học: Biphasic reductive unfolding of ribonuclease A is temperature dependent pdf

Tài liệu Báo cáo Y học: Biphasic reductive unfolding of ribonuclease A is temperature dependent pdf

Tài liệu Báo cáo Y học: Biphasic reductive unfolding of ribonuclease A is temperature dependent pdf

... Hamming distance was calculated instead of the mutual information. The reductive unfolding kinetics was analyzed by a linear expansion least-squares algorithm and graphically using a least mean ... analysis, which is established by us recently [4,11], was used to analyze the unfolding dynamics and also was introduced into the analysis of the thermal transition study by CD and...

Ngày tải lên: 21/02/2014, 01:21

9 434 0
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

... b-1,4-Endogalactanases cleave within the galactan moiety of type I arabinogalactan, releasing D -galacto-oligosaccharides. Bacterial b-1,4-endo- galactanases release mainly galactotriose and galactotetra- ose ... soy arabinogalactan consists of 57% D -galactose and 38% L -arabinose. Methylation analysis demonstrated that a substantial amount of the L -arabinose residues (14%) in soy a...

Ngày tải lên: 21/02/2014, 01:21

9 669 0
Tài liệu Báo cáo Y học: NMR-based determination of the binding epitope and conformational analysis of MUC-1 glycopeptides and peptides bound to the breast cancer-selective monoclonal antibody SM3 pptx

Tài liệu Báo cáo Y học: NMR-based determination of the binding epitope and conformational analysis of MUC-1 glycopeptides and peptides bound to the breast cancer-selective monoclonal antibody SM3 pptx

... Thr3 enhances binding affinity of glycopeptides to the antibody [18]. Conventional pepscan analysis however, does not allow easy analysis of the contribution of the carbohydrate portion. To assess ... GalNAc residue of PDT(O -a- D -GalNAc)RP receive overall less saturation than each of the amino acids. Only the N-acetyl methyl group has a strong STD NMR signal. It is very unlike...

Ngày tải lên: 21/02/2014, 15:20

12 718 0
Tài liệu Báo cáo Y học: Caged O2 Reaction of cytochrome bo3 oxidase with photochemically released dioxygen from a cobalt peroxo complex doc

Tài liệu Báo cáo Y học: Caged O2 Reaction of cytochrome bo3 oxidase with photochemically released dioxygen from a cobalt peroxo complex doc

... Tsukihara, T., Aoyama, H., Yamashita, E., Tomizaki, T., Yamaguchi, H., Shinzawa-Itoh, K., Nakashima, R., Yaono, R. & Yoshikawa, S. (1995) Structures of metal sites of oxidized bovine heart cytochrome ... cytochrome c oxidase at 2.8 A ˚ . Science 269, 1069–1074. 9. Tsukihara, T., Aoyama, H., Yamashita, E., Tomizaki, T., Yamaguchi, H., Shinzawa-Itoh, K., Nakashima, R., Yaono, R. &am...

Ngày tải lên: 21/02/2014, 15:20

8 474 0
Tài liệu Báo cáo Y học: Steady-state kinetics of the glutaminase reaction of CTP synthase from Lactococcus lactis The role of the allosteric activator GTP in coupling between glutamine hydrolysis and CTP synthesis potx

Tài liệu Báo cáo Y học: Steady-state kinetics of the glutaminase reaction of CTP synthase from Lactococcus lactis The role of the allosteric activator GTP in coupling between glutamine hydrolysis and CTP synthesis potx

... lactis enzyme, a plausible explanation may be that 4-phosphorylated UTP by itself acts as a weak activator of glutamine hydrolysis. This activation is greatly enhanced by GTP binding to the enzyme. From ... velocity data from the activation of CTP synthesis or glutaminase activity by GTP as measured spectrophotometrically was analysed using v ¼ k cat;1 ½Eþ k cat;2 ½E A K A þ A...

Ngày tải lên: 21/02/2014, 15:20

8 698 0
Tài liệu Báo cáo Y học: Expression and characterization of active site mutants of hevamine, a chitinase from the rubber tree Hevea brasiliensis docx

Tài liệu Báo cáo Y học: Expression and characterization of active site mutants of hevamine, a chitinase from the rubber tree Hevea brasiliensis docx

... strand 5¢-TGAACCATGCTCTATGGCAAAATCAATACCATC-3¢ Asp125Asn Sense strand 5¢-TTGGATGGTATTGATTTTAACATAGAGCATGGTTCAACC-3¢ Anti-sense strand 5¢-GGTTGAACCATGCTCTATGTTAAAATCAATACCATCCAA-3¢ Glu127Ala Sense ... strand 5¢-GGTATTGATTTTGACATAGCGCTATGTCAAAATCAATACC-3¢ Anti-sense strand 5¢-GTACAGGGTTGAACCATGCGCTATGTCAAAATCAATACC-3¢ Asp125Ala/Glu127Ala Sense strand 5¢-GATGGTATTGATTTTGCCATAGCGCATGGTTCAACCCTG-3...

Ngày tải lên: 22/02/2014, 04:20

9 616 0
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

... primer 5¢-d(TATTTGCATGGCC AGCCCAATCTATTTGAG)-3¢; Gly262 to Ala, upper primer 5¢-d(ATAGATTGGGGTGCCCATGCAAATAA TGCA)-3¢, lower primer 5¢-d(ATTATTTGCATGGGCA CCCCAATCTATTTG)-3¢; Tyr269 to Ala, upper ... role of a glycine cluster in cold adaptation of an alkaline phosphatase Konstantinos Mavromatis 1, *, Iason Tsigos 2, *, Maria Tzanodaskalaki 2 , Michael Kokkinidis 1,3 and Vassilis Bourioti...

Ngày tải lên: 22/02/2014, 04:20

6 489 0
Tài liệu Báo cáo Y học: Granule-bound starch synthase I A major enzyme involved in the biogenesis of B-crystallites in starch granules ppt

Tài liệu Báo cáo Y học: Granule-bound starch synthase I A major enzyme involved in the biogenesis of B-crystallites in starch granules ppt

... course of storage starch synthesis show that amylopectin and amylose synthesis are partly disconnected and that amylose synthesis persists when the rate of polysaccharide and amylopectin synthesis ... further and the rate of amylose synthesis accounts for most polysaccharide synthesis. At this stage the rate of amylopectin synthesis has become minimal and it is difficult to say if th...

Ngày tải lên: 22/02/2014, 07:20

11 556 0
Tài liệu Báo cáo Y học: Characterization and regulation of yeast Ca2+-dependent phosphatidylethanolamine-phospholipase D activity docx

Tài liệu Báo cáo Y học: Characterization and regulation of yeast Ca2+-dependent phosphatidylethanolamine-phospholipase D activity docx

... 2002 Characterization and regulation of yeast Ca 2+ -dependent phosphatidylethanolamine-phospholipase D activity Xiaoqing Tang, Michal Waksman, Yona Ely and Mordechai Liscovitch Department of Biological ... cellular localization. The stimulation of PtdEtn-PLD by Ca 2+ ions is biphasic. This pattern raises the possibility that Ca 2+ may have a dual mechanism of action in activa...

Ngày tải lên: 22/02/2014, 07:20

10 499 0
Tài liệu Báo cáo Y học: Presence and regulation of the endocannabinoid system in human dendritic cells potx

Tài liệu Báo cáo Y học: Presence and regulation of the endocannabinoid system in human dendritic cells potx

... 8675093, E-mail: vdimarzo@icmib.na.cnr.it Abbreviations: 2-AG, 2-arachidonoylglycerol; PalEtn, N-palmitoyl- ethanolamine; FAAH, fatty acid amide hydrolase; THC, D 9 -tetra- hydrocannabinol; LPS, lipopolysaccharide; ... anandamide and 2-arachidonoylglycerol (2-AG), the cannabinoid CB 1 and CB 2 receptors, and one of the enzymes mostly responsible for endocannabinoid hydrolysis, the fatty aci...

Ngày tải lên: 22/02/2014, 07:20

8 646 0
w