Tài liệu Báo cáo khoa học: "Multiple Default Inheritance in a Unification-Based" pdf
Tài liệu Báo cáo khoa học: "Multiple Default Inheritance in a Unification-Based" pdf
... inheritance& apos; in which direct inheritance is allowed from only one superclass at a time. The main advantage that multiple inheritance offers over simple inheritance is the ability to inherit ... of class definitions. In equs. tions, unification variables have initial capitals, and negation of constants is indicated by ' '. 'kk' is the string concatenation operator ... to alternatives at the same conceptual level in the hiersrchy, and in msny cases reflect the tra- ditional ides of 'paradigm'. Equations within a variant set are absolute constraints,...
- 7
- 362
- 0
Tài liệu Báo cáo khoa học: "Liars and Saviors in a Sentiment Annotated Corpus of Comments to Political debates" pdf
... opinions? Finally, approaches to opi-nion mining have implicitly assumed that the prob-lem at stake is a balanced classification problem, based on the general assumption that positive and negative ... identifying the most rele-vant challenges in mining opinions targeting media personalities, namely politicians, in comments posted by users to online news articles. We are interested in answering ... mentions are classifiable into syntactic-semantic categories; (vi) the opinionated sentences may be characterized according to their polarity 565and intensity; (vii) each opinionated sentence may...
- 5
- 499
- 0
Tài liệu Báo cáo khoa học: "Identifying Linguistic Structure in a Quantitative Analysis of Dialect Pronunciation" docx
... (Manning and Schütze,1999). Multidimensional scaling is data analysistechnique that provides a spatial display of the datarevealing relationships between the instances in thedata set (Davison, ... multidi-mensional scaling. The analyses showed that resultsobtained using aggregate analysis of word pronunci-ations mostly conform with the traditional phoneticclassification of Bulgarian dialects as ... that 3 factors are most im-portant, explaining 35% of the total amount of vari-ance. The main drawback of applying this technique in dialectometry is that it is not directly related to theaggregate...
- 6
- 651
- 0
Tài liệu Báo cáo khoa học: "Mapping Lexical Entries in a Verbs Database to WordNet Senses" doc
... (WSD) in several ways. First, thewords to be disambiguated are entries in a lexicaldatabase, not tokens in a text corpus. Second, wetake an “all-words”rather than a “lexical-sample”approach ... Sim-pleProd, and SimpleWtdSumMajSgl+Aggr: Majority vote of MajSim-pleSgl and MajAggrMajPair+Aggr: Majority vote of MajSim-plePair and MajAggrTable 2 gives recall and precision measures forall variations ... variations at their optimal votethresholds. In the AutoMap+ variation, Grid and Levin+probabilities abstain from voting when their val-ues are zero (a common occurrence, becauseof data sparsity...
- 8
- 415
- 0
Tài liệu Báo cáo khoa học: "Domain-transcending mappings in a system for metaphorical reasoning" docx
... viewneutral mapping adjuncts (VNMAs)1. We regardVNMAs as standard but implicit default aspectsof all view-specific metaphorical mappings. Theyare defaults in that they can, in principle, ... SPACEand IDEAS ARE PHYSICAL OBJECTS, con-taining the following relevant mappings:When a person's mind is being viewed as a physical space, an idea's being physically located in the space ... wecall View Neutral Mapping Adjuncts(VNMAs). We give a list of the mainVNMAs that appear to be required, andshow how they can be incorporated into a pre-existing system (ATT-Meta) formetaphorical...
- 6
- 455
- 0
Tài liệu Báo cáo khoa học: Multiple promoters regulate tissue-specific alternative splicing of the human kallikrein gene, KLK11⁄hippostasin ppt
... caused by using a planttranslation system, in which mammalian mRNA wasinappropriately translated. The transient expressionassay indicated that M33S and isoform 1 proteinswere secreted into the ... Mountain View, CA) was used as a template, because this organ abundantly expresses mRNAfor both isoforms 1 and 2. Oligo cap RACE was performedusing a Gene racer kit (Invitrogen, Carlsbad, CA), accord-ing ... 5¢-AGGAACCAAACACCAAGTGG-3¢(Fig. 2A) .Luciferase promoter assayHuman genomic DNA was isolated from two volunteers(both male, Japanese, aged 34 and 37 years) after they gaveinformed consent. A 1460...
- 9
- 544
- 0
Tài liệu Báo cáo khoa học: Multiple enzymic activities of human milk lactoferrin ppt
... only in half of 14 analyzed milk samples. A similarsituation was observed after separation of human milkproteins in a gel containing RNA; again LF was signifi-cantly more active in hydrolysing ... GGCACTTAC,TAGAAGATCAAA, and ACTACACATCTACA, corres-ponding to sequences to which it is known to bindand activate transcription [10], as well as different d(pN)10with comparable Kmvalues ... maximal activity was taken as100% and the activity of other subfractions was calculated as a percentage of that with maximal activity. Zero indicates the absence of any activity in the subfraction...
- 9
- 494
- 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc
... AYRAAYTCRWRBCCYTTCCARPE6 5a- FwdNM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACACRPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAGRPE65c-FwdNM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACACRPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAGRPE6 5a ... CCTTTGACATCGCAAGTGGATCARPE65c GSP-FwdNM_001113653 TTGAGGTGACAGACAATTGCCTRPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCGRPE6 5a- His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 ... GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. Takahashi et al. A novel isomerohydrolase in the retinaFEBS Journal 278 (2011) 2913–2926 ª 2011 The Authors Journal compilation ª 2011...
- 14
- 753
- 0
Tài liệu Báo cáo khoa học: Applications and trends in systems biology in biochemistry docx
... is insufficient to accuratelyexplain insulin-stimulated changes in the concentration of intracellularspecies and partitioning of glucosedisposal in skeletal muscle. Insulinpropagates a rather ... only activity able to convertpyruvate into acetyl-CoA. Tworedundant pathways for acetateassimilation are needed as a resultof a coupling between the TCA cycleand acetate activation to acetyl-CoAby ... activator of tran-scription, mitogen-activated protein kinase; LPS, lipopolysaccharide; MAPK, mitogen-activated protein kinase; MCF, macrophare chemotactic factor; MCIP, modulatory calcineurin-interact-ing...
- 91
- 733
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM