Tài liệu Báo cáo khoa học: "Multiple Default Inheritance in a Unification-Based" pdf

Tài liệu Báo cáo khoa học: "Multiple Default Inheritance in a Unification-Based" pdf

Tài liệu Báo cáo khoa học: "Multiple Default Inheritance in a Unification-Based" pdf

... inheritance& apos; in which direct inheritance is allowed from only one superclass at a time. The main advantage that multiple inheritance offers over simple inheritance is the ability to inherit ... of class definitions. In equs. tions, unification variables have initial capitals, and negation of constants is indicated by ' '. 'kk' is the string concate...

Ngày tải lên: 20/02/2014, 21:20

7 362 0
Tài liệu Báo cáo khoa học: "Liars and Saviors in a Sentiment Annotated Corpus of Comments to Political debates" pdf

Tài liệu Báo cáo khoa học: "Liars and Saviors in a Sentiment Annotated Corpus of Comments to Political debates" pdf

... opinions? Finally, approaches to opi- nion mining have implicitly assumed that the prob- lem at stake is a balanced classification problem, based on the general assumption that positive and negative ... identifying the most rele- vant challenges in mining opinions targeting media personalities, namely politicians, in comments posted by users to online news articles. We are interest...

Ngày tải lên: 20/02/2014, 05:20

5 499 0
Tài liệu Báo cáo khoa học: "Identifying Linguistic Structure in a Quantitative Analysis of Dialect Pronunciation" docx

Tài liệu Báo cáo khoa học: "Identifying Linguistic Structure in a Quantitative Analysis of Dialect Pronunciation" docx

... (Manning and Schütze, 1999). Multidimensional scaling is data analysis technique that provides a spatial display of the data revealing relationships between the instances in the data set (Davison, ... multidi- mensional scaling. The analyses showed that results obtained using aggregate analysis of word pronunci- ations mostly conform with the traditional phonetic classification of Bulgaria...

Ngày tải lên: 20/02/2014, 12:20

6 651 0
Tài liệu Báo cáo khoa học: "Mapping Lexical Entries in a Verbs Database to WordNet Senses" doc

Tài liệu Báo cáo khoa học: "Mapping Lexical Entries in a Verbs Database to WordNet Senses" doc

... (WSD) in several ways. First, the words to be disambiguated are entries in a lexical database, not tokens in a text corpus. Second, we take an “all-words”rather than a “lexical-sample” approach ... Sim- pleProd, and SimpleWtdSum MajSgl+Aggr: Majority vote of MajSim- pleSgl and MajAggr MajPair+Aggr: Majority vote of MajSim- plePair and MajAggr Table 2 gives recall and precision mea...

Ngày tải lên: 20/02/2014, 18:20

8 415 0
Tài liệu Báo cáo khoa học: "Domain-transcending mappings in a system for metaphorical reasoning" docx

Tài liệu Báo cáo khoa học: "Domain-transcending mappings in a system for metaphorical reasoning" docx

... view neutral mapping adjuncts (VNMAs) 1 . We regard VNMAs as standard but implicit default aspects of all view-specific metaphorical mappings. They are defaults in that they can, in principle, ... SPACE and IDEAS ARE PHYSICAL OBJECTS, con- taining the following relevant mappings: When a person's mind is being viewed as a physical space, an idea's being physically located...

Ngày tải lên: 22/02/2014, 02:20

6 455 0
Tài liệu Báo cáo khoa học: Multiple promoters regulate tissue-specific alternative splicing of the human kallikrein gene, KLK11⁄hippostasin ppt

Tài liệu Báo cáo khoa học: Multiple promoters regulate tissue-specific alternative splicing of the human kallikrein gene, KLK11⁄hippostasin ppt

... caused by using a plant translation system, in which mammalian mRNA was inappropriately translated. The transient expression assay indicated that M33S and isoform 1 proteins were secreted into the ... Mountain View, CA) was used as a template, because this organ abundantly expresses mRNA for both isoforms 1 and 2. Oligo cap RACE was performed using a Gene racer kit (Invitrogen, Carlsb...

Ngày tải lên: 19/02/2014, 06:20

9 544 0
Tài liệu Báo cáo khoa học: Multiple enzymic activities of human milk lactoferrin ppt

Tài liệu Báo cáo khoa học: Multiple enzymic activities of human milk lactoferrin ppt

... only in half of 14 analyzed milk samples. A similar situation was observed after separation of human milk proteins in a gel containing RNA; again LF was signifi- cantly more active in hydrolysing ... GGCACTTAC, TAGAAGATCAAA, and ACTACACATCTACA, corres- ponding to sequences to which it is known to bind and activate transcription [10], as well as different d(pN) 10 with comparable K m...

Ngày tải lên: 21/02/2014, 00:20

9 494 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... AYRAAYTCRWRBCCYTTCCA RPE6 5a- Fwd NM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAG RPE6 5a ... CCTTTGACATCGCAAGTGGATCA RPE65c GSP-Fwd NM_001113653 TTGAGGTGACAGACAATTGCCT RPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCG RPE6 5a- His-Fwd NM_200751 GCGGCCGCCACCATGCA...

Ngày tải lên: 14/02/2014, 14:20

14 754 0
Tài liệu Báo cáo khoa học: Applications and trends in systems biology in biochemistry docx

Tài liệu Báo cáo khoa học: Applications and trends in systems biology in biochemistry docx

... is insufficient to accurately explain insulin-stimulated changes in the concentration of intracellular species and partitioning of glucose disposal in skeletal muscle. Insulin propagates a rather ... only activity able to convert pyruvate into acetyl-CoA. Two redundant pathways for acetate assimilation are needed as a result of a coupling between the TCA cycle and acetate activation...

Ngày tải lên: 14/02/2014, 14:20

91 733 0
Từ khóa:
w