Tài liệu Báo cáo khoa học: "Translating a Unification Grammar with Disjunctions into Logical Constraints" pdf
Tài liệu Báo cáo khoa học: "Translating a Unification Grammar with Disjunctions into Logical Constraints" pdf
... Translating a Unification Grammar with Disjunctions into Logical Constraints
Mikio Nakano and Akira Shimazu*
NTT Basic Research Laboratories
3-1 Morinosato-Wakamiya, Atsugi 243-0198 Japan ... unification- based approach is
that it enables us to describe grammar declaratively,
making the development and amendment of grammar
easy.
Analysis systems that are based on un...
Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf
... 5¢-GGGAATTCCATATGAGAGACAATA
TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT
CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,and
PDE1(Lys321–Thr620) was amplified with primers 5¢-GGG
AATTCCATATGAAGAATGATCAATCTGGCTGCG
GCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGG
TTCCCTGTCCAGTGTTACC-3¢. ... The African trypanosome
Trypanosoma brucei is the protozoon that causes the fatal
human sleeping sickness, as well as Nagana, a devas...
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf
... Tsubouchi H, Naka D, Takahashi K,
Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy-
ama O, Takahashi K et al. (1989) Molecular cloning
and sequence analysis of cDNA for human hepatocyte
growth factor. ... Yokohama, Japan
2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, Japan
Introduction
Type II transmembrane serine proteases (TT...
Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx
... (Hartmann Analytic, Braunschweig, Germany) was
added. The supernatants were extracted with XAD16 resin
after an additional 2 days of growth. The dried eluate was
dissolved in 10% methanol and analyzed ... from bacterial genomics. Nat Prod Rep
24, 1073–1109.
32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H,
Naganawa H, Hamada M & Takeuchi T (1985) For-
oxymithine, a new inhibitor of...
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf
... antisense AGCTGATCTTCGAAGATCTTCGAAGAT
Mutated HSE
sense
Biotin-TCGACTT
CAAGCTTGTACAAGCTTGTAG
Mutated HSE
antisense
AGCTGAAGTTCGAACATGTTCGAACATC
‘Scrambled’
oligonucleotide
Biotin-AACGACGGTCGCTCCGCCTGGCT
140
40
60
80
100
120
Counts ... h
D
1 h
Autoradiography
Add D beads and incubate
D A
O
2
Read AlphaLISA si
g
nal at 615 nm
HSE
Fig. 1. Comparison of EMSA and TransLISA for the detection of H...
Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt
... Shigeno M, Nako K, Ichikawa T, Suzuki K, Kawakami
A, Abiru S, Miyazoe S, Nakagawa Y, Ishikawa H,
Hamasaki K et al. (2003) Interferon -a sensitizes human
hepatoma cells to TRAIL-induced apoptosis ... 40760–40767.
34 Yamada H, Tada-Oikawa S, Uchida A & Kawanishi S
(1999) TRAIL causes cleavage of bid by caspase-8 and
loss of mitochondrial membrane potential resulting in
apoptosis in BJAB...
Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx
... were analyzed and
quantified on a Fuji Bio-Imaging analyzer BAS-2500 using
IMAGE GAUGE
V3.3 software.
Chromatin and protein–DNA analysis
Micrococcal nuclease (MNase) digestion and in situ cleavage
by ... Biotechnology) and acetylated H3 (Upstate Bio-
technology), and antibodies against specific modifications
such as acetylated H3-K9 (Cell Signaling Technology) and
H3-K14 (Abcam) and anti-H3 C-...
Tài liệu Báo cáo khoa học: "Creating a manually error-tagged and shallow-parsed learner corpus" pptx
... corpus
Ryo Nagata
Konan University
8-9-1 Okamoto,
Kobe 658-0072 Japan
rnagata @ konan-u.ac.jp.
Edward Whittaker Vera Sheinman
The Japan Institute for
Educational Measurement Inc.
3-2-4 Kita-Aoyama, Tokyo, ... North
American Chapter of the ACL, pages 154–162.
Joel Tetreault, Elena Filatova, and Martin Chodorow.
201 0a. Rethinking grammatical error annotation and
evaluation with the Amazon Me...
Tài liệu Báo cáo khoa học: "MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages" pdf
... We also integrate the sentiment-detection
system with a real-time rule-based harmonic
music and animation generator to display
streams of messages in an audiovisual format.
Conceptually, ... messages in microblogs. Our system can be
regarded as a sentiment-driven, music-based sum-
marization framework as well as a novel audiovis-
ual presentation of art. MemeTube is designed as...
Tài liệu Báo cáo khoa học: "Collecting a Why-question corpus for development and evaluation of an automatic QA-system" pdf
... each paid reward.
• Qualifications To improve the data quality,
a HIT can also be attached to certain tests,
“qualifications” that are either system-provided
or created by the requester. An example ... both answers. We calculated the overall average
agreement ratio (Total Avg) and the average of the
best matches between two assignments within one
HIT (Best Match). We ran the test for two data...
Từ khóa: