Tài liệu Báo cáo khoa học: "Updating a Name Tagger Using Contemporary Unlabeled Data" ppt

... Ng and Cardie, 2003; Mota and Grishman, 2008). In particular, we showed that the perfor- mance of a name tagger based on co-training de- cays as the time gap between training data (seeds and unlabeled ... AFNLP Updating a Name Tagger Using Contemporary Unlabeled Data Cristina Mota L2F (INESC-ID) & IST & NYU Rua Alves Redol 9 1000-029 Lisboa Portugal cmota@ist.utl.p...

Ngày tải lên: 20/02/2014, 09:20

... are a useful and abundant source of data for natural language processing, but selecting relevant data for the task at hand is not trivial. In this paper we introduce a scalable ap- proach for automatically ... edits clas- sification as factual or fluency edits. It adopts a supervised machine learning approach and uses character- and word- level features, part- of-speech tags, named entiti...

Ngày tải lên: 22/02/2014, 03:20

... Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy- ama O, Takahashi K et al. (1989) Molecular cloning and sequence analysis of cDNA for human hepatocyte growth factor. ... Technology, Nagatsuta, Midori-ku, Yokohama, Japan 2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, Japan Introduction Type II...

Ngày tải lên: 15/02/2014, 01:20

... from bacterial genomics. Nat Prod Rep 24, 1073–1109. 32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H, Naganawa H, Hamada M & Takeuchi T (1985) For- oxymithine, a new inhibitor of angiotensin-converting enzyme, ... (Hartmann Analytic, Braunschweig, Germany) was added. The supernatants were extracted with XAD16 resin after an additional 2 days of growth. The dried eluate was dissolved...

Ngày tải lên: 16/02/2014, 09:20

... antisense AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ... procedure The assay was run as a three-step assay: initial incubation of the sample and probe, addition and incubation of the sample and acceptor beads in the...

Ngày tải lên: 18/02/2014, 14:20

... Ichikawa T, Suzuki K, Kawakami A, Abiru S, Miyazoe S, Nakagawa Y, Ishikawa H, Hamasaki K et al. (2003) Interferon -a sensitizes human hepatoma cells to TRAIL-induced apoptosis through DR5 upregulation ... 40760–40767. 34 Yamada H, Tada-Oikawa S, Uchida A & Kawanishi S (1999) TRAIL causes cleavage of bid by caspase-8 and loss of mitochondrial membrane potential resulting in apoptosis i...

Ngày tải lên: 19/02/2014, 06:20

... 5¢-GGGAATTCCATATGAGAGACAATA TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,and PDE1(Lys321–Thr620) was amplified with primers 5¢-GGG AATTCCATATGAAGAATGATCAATCTGGCTGCG GCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGG TTCCCTGTCCAGTGTTACC-3¢. ... parasites as potential targets for antiparasitic drugs. The African trypanosome Trypanosoma brucei is the protozoon that causes the fatal...

Ngày tải lên: 19/02/2014, 12:20

... were analyzed and quantified on a Fuji Bio-Imaging analyzer BAS-2500 using IMAGE GAUGE V3.3 software. Chromatin and protein–DNA analysis Micrococcal nuclease (MNase) digestion and in situ cleavage by ... Biotechnology) and acetylated H3 (Upstate Bio- technology), and antibodies against specific modifications such as acetylated H3-K9 (Cell Signaling Technology) and H3-K14 (Abcam) and anti-H3...

Ngày tải lên: 19/02/2014, 12:20

... Computational Linguistics Creating a manually error-tagged and shallow-parsed learner corpus Ryo Nagata Konan University 8-9-1 Okamoto, Kobe 658-0072 Japan rnagata @ konan-u.ac.jp. Edward Whittaker ... 44th Annual Meeting of ACL, pages 241–248. Katsuaki Okihara. 1985. English writing (in Japanese). Taishukan, Tokyo. Alla Rozovskaya and Dan Roth. 201 0a. Annotating ESL errors: Challenges and...

Ngày tải lên: 20/02/2014, 04:20

... We also integrate the sentiment-detection system with a real-time rule-based harmonic music and animation generator to display streams of messages in an audiovisual format.  Conceptually, ... In recent years, a number of studies have inves- tigated integrating emotions and music in certain media applications. For example, Ishizuka and Onisawa (2006) generated variations of theme ....

Ngày tải lên: 20/02/2014, 05:20