Tài liệu Báo cáo khoa học: Unraveling the catalytic mechanism of lactoperoxidase and myeloperoxidase A reflection on some controversial features Elena Ghibaudi and Enzo Laurenti docx
... mechanism of lactoperoxidase and myeloperoxidase A reflection on some controversial features Elena Ghibaudi and Enzo Laurenti Dipartimento di Chimica I.F.M., Universita ` di Torino, Italy Although ... formulated a hypo- thesis that describes an integrated vision of the catalytic mechanism of both enzymes. The main points are: (a) a re-evaluation...
Ngày tải lên: 20/02/2014, 02:21
... ratios: at a 1 : 1 Fe 2+ ⁄ protein ratio, the resonances of Arg20, Asp22 and Asp23 disap- peared, and the resonance of Leu21 shifted. At a 2 : 1 ratio, the resonances of residues 19 and 44 also ... spectrum of CyaY, but the most striking consequence of the addi- tion was the total disappearance of specific resonances without the concomitant appearance of o...
Ngày tải lên: 18/02/2014, 16:20
... the V20 5A mutant (B) and WT AtdA3 (C). Also shown are the mononuclear iron (brown sphere) and the catalytic facial triad of H204, H209 and D356. (D,E) Molecular sur- faces of the substrate channel ... deletion assay, the atdA1 gene was amplified using the A1 _EcoRI_F and A1 _SalI_R primers. The atdA2 gene was amplified using the A2 _FseI_F and A2 _AvrII_R p...
Ngày tải lên: 19/02/2014, 02:20
Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx
... pair similarity computation since the other parts of speech (adjectives and adverbs) do not have a taxonomic representation structure. For example, the jcn similarity measure (Jiang and Conrath, ... [SE07], and Semcor. We tune the parameters in wmfvec and other base- lines based on SE2, and then directly apply the tuned models on other three data sets. Data: The se...
Ngày tải lên: 19/02/2014, 19:20
Tài liệu Báo cáo khoa học: Mapping the functional domains of human transcobalamin using monoclonal antibodies pptx
... were Table 3. Specificity of monoclonal anti-(human transcobalamin) sera and their effect on the functional properties of transcobalamin. nd, not done. mAb Epitope cluster Precipitation of Apo-TC ... the maximal mAb ⁄ heparin effect on the functional activ- ity of TC. Arrows show the hypothetical movement of the domains after attachment of Cbl, see the main text....
Ngày tải lên: 20/02/2014, 01:20
Tài liệu Báo cáo khoa học: "Understanding the Semantic Structure of Noun Phrase Queries" pptx
... domains, Movie, Job and National Park, and had them manually anno- tated. The annotation was given on both segmen- tation of the queries and classification of the seg- ments according to the label ... tagged as Brand. In particular, Li et al. leveraged click- through data and a database to automatically de- rive training data for learning a CRF-based tagger. Manshadi...
Ngày tải lên: 20/02/2014, 04:20
Tài liệu Báo cáo khoa học: "Identifying the Semantic Orientation of Foreign Words" pdf
... polar- ity. They assign any given word the label of its syn- onyms or the opposite label of its antonyms if any of them are known. Kanayama and Nasukawa (2006) used syntactic features and context ... construct a network of words using gloss definitions, thesaurus and co- occurrence statistics. They regard each word as an electron. Each electron has a spin and each spi...
Ngày tải lên: 20/02/2014, 05:20
Tài liệu Báo cáo khoa học: Mapping the functional domain of the prion protein docx
... GCCCCATGGCGGTGGATGGCATATGGGAGG GGGTACCC PrP105–231 GGAACAAGCCCAGCCATATGAAAACCAACC TCAAGC PrP113–231 CCAACCTCAAGCATATGGCAGGG PrPD35–45 GGGTGGAACACCGGTGGCAACCGTTACCC PrP112–119 CCTCAAGCATGTGGTAGTGGGGGGCC PrPD112–136 CCAACCTCAAGCATGTGATGATCCATTTTGGC PrPD135–150 ... 112–136 constitute part of the functional domain of the protein provides a plausible explanation for the high evolutiona...
Ngày tải lên: 21/02/2014, 00:20
Tài liệu Báo cáo khoa học: "Selecting the “Right” Number of Senses Based on Clustering Criterion Functions" pdf
... 1 N , and then determines the mean and standard deviation of the criterion function. Then, a score is computed for each value of k by sub- tracting the mean from the criterion function, and dividing ... and the 6 sense noun line. We also created 19 name conflations where sets of 2, 3, 4, and 6 names of persons, places, or organizations that are included in the E...
Ngày tải lên: 22/02/2014, 02:20
Tài liệu Báo cáo khoa học: "Evaluating the Inferential Utility of Lexical-Semantic Resources" ppt
... 2007; Kazama and Tori- sawa, 2007). As of today, only a partial comparative picture is available regarding the actual utility and limi- tations of available resources for lexical-semantic inference. ... inference, are commonly utilized by ap- plied inference systems (Giampiccolo et al., 2007) and applications such as Information Retrieval and Question Answering (Shah and Cro...
Ngày tải lên: 22/02/2014, 02:20