Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt

Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt

Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt

... Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis Hiroaki Matsuo, Kunie Kohno and Eishin Morita Department ... DNA AMPLIFIER MIR-D40 (Sanyo, Osaka, Japan). To amplify the DNA frag- ments containing a complete x-5 gliadin gene, oligonucleo- tides, 5 ¢-AAGTGAG...

Ngày tải lên: 20/02/2014, 01:20

8 484 0
Tài liệu Báo cáo khoa học: Molecular cloning and characterization of soybean protein disulfide isomerase family proteins with nonclassic active center motifs pdf

Tài liệu Báo cáo khoa học: Molecular cloning and characterization of soybean protein disulfide isomerase family proteins with nonclassic active center motifs pdf

... (TaKaRa Bio Inc.). Forward primers 5¢-CG TTTGAAGGGTGAGGAGGAAAA[FAM]G-3¢ and 5¢-CA CAAGAGAGTTCTGCGATAACCTTG[FAM]G-3¢ (Invi- trogen Corporation) and reverse primers 5¢-AAGTAGGCA ACAAAACAACG-3¢ and ... 77–99. 16 Kamauchi S, Wadahama H, Iwasaki K, Nakamoto Y, Nishizawa K, Ishimoto M, Kawada T & Urade R (2008) Molecular cloning and characterization of two soybean protein disulfide i...

Ngày tải lên: 18/02/2014, 11:20

12 622 0
Tài liệu Báo cáo khoa học: Molecular characterization, phylogenetic relationships, and developmental expression patterns of prion genes in zebrafish (Danio rerio) doc

Tài liệu Báo cáo khoa học: Molecular characterization, phylogenetic relationships, and developmental expression patterns of prion genes in zebrafish (Danio rerio) doc

... and amino acid positions (Fig. 2) indicated that zebrafish PrP1 is, as PrP2, a member of the PrP family. Analysis of the N-terminal repeat domain of zebrafish PrP1 and PrP2 The N-terminal domain ... and Tyr218 (Fig. 2). The functional importance of invariant amino acids of the corresponding alpha-helical C-terminal globular domain of human PrP C can be demonstrated with Pro1...

Ngày tải lên: 19/02/2014, 16:20

14 548 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

... 2005) doi:10.1111/j.1742-4658.2005.04814.x Staphylococcal nuclease (SNase) is a model protein that contains one domain and no disulfide bonds. Its stability in the native state may be maintained mainly by key amino acids. In this ... Hueih-Min Chen 1 1 Institute of BioAgricultural Sciences, Academia Sinica, Taipei, Taiwan, ROC 2 Institute of Physics, Academia Sinica, Taipei, Taiwan...

Ngày tải lên: 20/02/2014, 01:20

7 552 0
Tài liệu Báo cáo khoa học: "What lies beneath: Semantic and syntactic analysis of manually reconstructed spontaneous speech" pdf

Tài liệu Báo cáo khoa học: "What lies beneath: Semantic and syntactic analysis of manually reconstructed spontaneous speech" pdf

... downstream processes such as infor- mation extraction and question answering. Reli- ably identifying and assigning these roles to gram- matical text is an active area of research (Gildea and Jurafsky, ... corpus and the manual semantic role labeling it includes. Section 3 analyzes structural differences between verbatim and reconstructed text in the SSR as evaluated by a combi...

Ngày tải lên: 20/02/2014, 07:20

9 511 0
Tài liệu Báo cáo khoa học: "Prosodic Aids to Syntactic and Semantic Analysis of Spoken English" ppt

Tài liệu Báo cáo khoa học: "Prosodic Aids to Syntactic and Semantic Analysis of Spoken English" ppt

... advantage of intonational struc- ture in spoken sentence understanding in the combinatory categorial grammar formalism. (Bear & Price 1990) discusses integrating proso- dy and syntax in ... INTRODUCTION In attempting to merge speech recognition and natural language understanding to produce a system capable of understanding spoken dia- logues, we are confronted with...

Ngày tải lên: 20/02/2014, 21:20

8 444 0
Tài liệu Báo cáo khoa học: "An ISU Dialogue System Exhibiting Reinforcement Learning of Dialogue Policies: Generic Slot-filling in the TALK In-car System" pot

Tài liệu Báo cáo khoa học: "An ISU Dialogue System Exhibiting Reinforcement Learning of Dialogue Policies: Generic Slot-filling in the TALK In-car System" pot

... (a java OAA agent), Database agent (java OAA wrappe r to MySQL). 5.1 Dialogue Policy Learner Age nt This agent acts as an interface between the DIPPER dialogue manager and the sy stem simulation ... which: contains an interface to a dialogue strategy learner module, covers a realistic domain of useful in- car” con- versation and a wide range of dialogue phenom- ena (e.g . confir...

Ngày tải lên: 22/02/2014, 02:20

4 394 0
Tài liệu Báo cáo khoa học: Molecular basis of glyphosate resistance – different approaches through protein engineering doc

Tài liệu Báo cáo khoa học: Molecular basis of glyphosate resistance – different approaches through protein engineering doc

... GO cata- lyzes the dioxygen-dependent oxidative deamination of primary and secondary amines (sarcosine, N-ethylgly- cine, and glycine) and d-amino acids (d-alanine and d- proline), yielding the ... helices a1 and a2 , and loop 130, spanning strands b6 and b7. Eight amino acids interact directly (< 4 A ˚ ) with GriP: the majority of contacts are made between charged gr...

Ngày tải lên: 14/02/2014, 14:20

14 795 0
Tài liệu Báo cáo khoa học: Molecular defect of isovaleryl-CoA dehydrogenase in the skunk mutant of silkworm, Bombyx mori ppt

Tài liệu Báo cáo khoa học: Molecular defect of isovaleryl-CoA dehydrogenase in the skunk mutant of silkworm, Bombyx mori ppt

... Fukuoka, Japan 3 Division of Insect Sciences, National Institute of Agrobiological Sciences, Tsukuba, Ibaraki, Japan 4 Agricultural Bioinformatics Research Unit, Graduate School of Agricultural and ... odour. One of the most intriguing features of the sku mutant is that the mature larva accumulates branched-chain amino a cids, leucine, isoleucine and valine, in haemolymph at...

Ngày tải lên: 18/02/2014, 04:20

12 631 0
Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding specificity and target candidates doc

Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding specificity and target candidates doc

... function ugcgucugaca UGUACAGCcccugccaaauuuuaauaggcaat AGUAAAUAaauaacgacaagaagcaaaugg At5g24490 (1) Ribosomal protein; unknown function cucaucucuccuuacaguuuaccuguguaggaguuaggguucuuga auaaacaaugcaacaaagauuguagaagucag UGUACAUA At4g36040 ... and 5¢-GTCAAACATTTCTCAACAACGTGTGAAGCAAAC TTCTGTTGG-3¢ (reverse) to APUM-2 and 5¢-CGATG CAGAAATTCAGTAGCAACATGGTGGAACGATGTC TCA-3¢ (forward) and 5¢-GCATG...

Ngày tải lên: 18/02/2014, 06:20

15 586 0
Từ khóa:
w