Tài liệu Báo cáo khoa học: Synergistic activation of signalling to extracellular signal-regulated kinases 1 and 2 by epidermal growth factor and 4b-phorbol 12-myristate 13-acetate pptx
Tài liệu Báo cáo khoa học: Synergistic activation of signalling to extracellular signal-regulated kinases 1 and 2 by epidermal growth factor and 4b-phorbol 12-myristate 13-acetate pptx
... Synergistic activation of signalling to extracellular signal-regulated kinases 1 and 2 by epidermal growth factor and 4b-phorbol 12 -myristate 13 -acetate Jorrit J. Hornberg 1 , Marloes ... ttp://www.bio.vu.nl/vakgroepen/mcp/ (Received 2 2 June 20 04, accepted 6 August 20 04) Eur. J. Biochem. 2 71, 3905–3 913 (20 04) Ó FEBS 20 04 doi :10 .11 11/ j...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: The mechanism of a-proton isotope exchange in amino acids catalysed by tyrosine phenol-lyase doc
... k f (s )1 ) k r (s )1 ) L -Phenylalanine 2 H 2 O 1. 14 ± 0 .11 14 .9 ± 0.35 3 .1 ± 0 .24 [a- 2 H]- L -Phenylalanine 2 H 2 O 0. 81 ± 0.39 1. 52 ± 0 .17 1. 28 ± 0 .15 L -Phenylalanine H 2 O 0. 92 ± 0 .11 14 .1 ± 0.4 7.46 ... 20 04, accepted 8 October 20 04) Eur. J. Biochem. 2 71, 4565–45 71 (20 04) Ó FEBS 20 04 doi :10 .11 11/ j .14 32 -10 33 .20 04.04 428 .x...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: Quantitative analysis of the experimental O–J–I–P chlorophyll fluorescence induction kinetics Apparent activation energy and origin of each kinetic step Steve Boisvert, David Joly and Robert Carpentier doc
... Trois-Rivie ` res, Que ´ bec, Canada G9A 5H7 Fax: +1 819 376 5057 E-mail: Robert.Carpentier@uqtr.ca (Received 17 May 20 06, revised 10 July 20 06, accepted 22 August 20 06) doi :10 .11 11/ j .17 42- 4658 .20 06.05475.x Fluorescence ... nonphotochemical quenching; PQ, plastoquinone; PS, photosystem; Q A and Q B , primary and secondary quinone acceptors of photosystem II; t 1 ⁄...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Molecular basis of glyphosate resistance – different approaches through protein engineering doc
... 820 ± 20 41 ± 4 20 Y 118 F 60 ± 3 5 .2 ± 0 .1 11. 5 Reversions in R7 to native amino acids T132I 14 70 ± 30 0.74 ± 0.04 19 90 V135I 21 0 0 ± 90 1. 5 ± 0 .1 1400 F31Y 10 80 ± 40 0.38 ± 0. 01 28 40 A 114 V 21 0 0 ... 21 1 00 Varese, Italy Fax: +3 32 4 21 5 00 Tel: +3 32 4 21 5 06 E-mail: loredano.pollegioni@uninsubria.it (Received 14 April 2 011 , revised 1 June 2 011 ,...
Ngày tải lên: 14/02/2014, 14:20
Tài liệu Báo cáo khoa học:Tyrosine phosphorylation of tau regulates its interactions with Fyn SH2 domains, but not SH3 domains, altering the cellular localization of tau ppt
... et al. 29 32 FEBS Journal 27 8 (2 011 ) 29 27 29 37 ª 2 011 The Authors Journal compilation ª 2 011 FEBS In the work presented here, P 21 6 A and P233A mutant tau proteins were correctly synthesized and expressed ... 13 82 740 359 Tel: +44 13 82 740 347 E-mail: R.Williamson@dundee.ac.uk *These authors contributed equally to this work (Received 19 April 2 011 , revised 2...
Ngày tải lên: 14/02/2014, 14:20
Tài liệu Báo cáo khoa học: Crystal structure of an ascomycete fungal laccase from Thielavia arenaria – common structural features of asco-laccases ppt
... ) 0. 21 ) 0 .17 K m (lM) 18 ± 1 9.5 ± 0.9 12 2 ± 11 13 2 ± 22 ND ND V max (dA min )1 Ænmol )1 ) 12 6 ± 2 11 9 ± 1 3.5 ± 0 .1 12 .1 ± 0.6 ND ND TaLcc1 (E° = 0. 51 V) DE° (V) ) 0. 02 0 .11 ) 0.06 0 ) 0 .18 ... +358 13 2 513 390 Tel: +358 13 2 513 359 E-mail: nina.hakulinen@uef.fi (Received 8 March 2 011 , revised 20 April 2 011 , accepted 27 April 2 011...
Ngày tải lên: 14/02/2014, 18:20
Tài liệu Báo cáo khoa học: Crystal structure of importin-a bound to a peptide bearing the nuclear localisation signal from chloride intracellular channel protein 4 ppt
... 8.8 89.4 0. 91 ⁄ 0. 81 P2 Lys203 0 ⁄ 6 ⁄ 13 ⁄ 31 ⁄ 1 3 15 .9 18 .9 14 5.3 0.96 ⁄ 0.97 P3 Lys204 3 ⁄ 5 ⁄ 01 20 ⁄ 0 2. 2 8.0 10 .2 12 8.4 0.98 ⁄ 0. 92 P4 Tyr205 0 ⁄ 8 ⁄ 01 30 ⁄ 1 3.3 13 .5 16 .8 13 3.8 0.96 ... 9385 45 52 E-mail: P.Curmi@unsw.edu.au (Received 17 November 2 010 , revised 31 January 2 011 , accepted 23 February 2 011 ) doi :10 .11 11/ j .17 42- 4658...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt
... and Laboratory Services ⁄ SW Division, Pall Corporation, Houston, TX 77040, USA (Received 29 November 2 010 , revised 2 February 2 011 , accepted 10 March 2 011 ) doi :10 .11 11/ j .17 42- 4658 .2 011 .080 91. x PCR ... amplicon size (bp) 1G1P1 Group 1 CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT DENV -1 104 51 106 71 21 9 1G1P1 Group 1 CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATG...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu Báo cáo khoa học: Crystal structure of the cambialistic superoxide dismutase from Aeropyrum pernix K1 – insights into the enzyme mechanism and stability pdf
... (°) D165-M-H79 10 4.8 ± 1. 3 97 .2 ± 2. 9 H79-M-H169 13 6 .1 ± 0.8 15 1.5 ± 2 .1 H79-M-wat a 77 .1 ± 1. 9 Wat a -M-H169 74.5 ± 0.6 H169-M-D165 11 8.8 ± 0.8 11 1 .1 ± 1. 5 H 31- M-D165 82. 7 ± 0.6 82 .1 ± 1. 2 H 31- M-wat b 17 0 .1 ... r(I) a 18 .1 (2. 9) 15 .9 (5.8) 16 .6 (3.6) B-factors of data from Wilson plot (A ˚ 2 ) 19 .8 13 .8 18 .3 Refinement Resolution...
Ngày tải lên: 14/02/2014, 22:20
Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt
... 14 .3 2. 0 QS 0 .18 84 2 610 24 .2 4 .2 S 0. 31 61 640 41. 2 17 .2 MQ 0. 52 52 2 91 69.0 36.0 1a 2a 3a 1b 2b 3b kDa 22 0 13 0 10 0 55 35 25 15 10 0 60 45 30 20 kDa Fig. 2. Homogeneity of purified R2F eluted from ... g x = 2. 0090, g y = 2. 0044, g z = 2. 0 022 , one b- 1 H-hyperfine-ten- sor (1. 18, 1. 11, 1. 11 mT) and two a- 1 H-hyperfine tensors ()0. 32,...
Ngày tải lên: 15/02/2014, 01:20