... covalent modifications of the enzyme, the effect of the inhibitor on the molecular mass value of HAD was measured; instead of an adduct increase, or no change, the value had unexpectedly decreased from 22 ... mod- ifications [42]. Fig. 9. ECD spectral data from the RNase A deamidation samples of Fig. 8. Deamidation at an individual residue of a specific product causes...
Ngày tải lên: 18/02/2014, 16:20
... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) ... (5¢-TGGTACTCGAG CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4...
Ngày tải lên: 19/02/2014, 17:20
Tài liệu Báo cáo khoa học: Complete subunit sequences, structure and evolution of the 6 · 6-mer hemocyanin from the common house centipede, Scutigera coleoptrata pptx
... bp of the respective 5¢ untranslated regions and the entire 3¢ untranslated regions. The standard polyadenylation signals (AATAAA) and the poly (A) -tails of different lengths are present in each ... crustacean and insect hemocyanins. All analyses support a pancrustacean taxon of the insect and crustacean proteins that excludes the myriapod hemocyanins. Within the clade...
Ngày tải lên: 20/02/2014, 11:20
Tài liệu Báo cáo khoa học: Processing, catalytic activity and crystal structures of kumamolisin-As with an engineered active site pptx
... deproto- nated at neutral pH to make a hydrogen bond with the side chain of Ser278 and act as a weak general base catalyst (without the help of Asp82), making an inefficient surrogate of the c-carboxy ... active sites of these enzymes contain a unique catalytic triad, Ser-Glu-Asp, in place of the canonical Ser-His-Asp triad of the classical serine peptidases. In th...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khóa học: The PAS fold A redefinition of the PAS domain based upon structural prediction ppt
... this alignment that all PAS- annotated A. thaliana proteins also contain a PAC motif, and conversely that all PAC- annotated A. thaliana proteins contain a PAS domain. Therefore, in the case of A. ... multiple PAS domains, created a list of 958 PAS sequences. The PFAM-alignment of the PAS domains was used as an initial alignment. All amino acid residues extend...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: X-ray crystallographic and NMR studies of pantothenate synthetase provide insights into the mechanism of homotropic inhibition by pantoate docx
... in A. thaliana PS. Val111 and Gly113, on the other hand, are both affected by both pantoate and ATP. These residues have their positional equivalents in Val137 and Arg139 in A. thaliana PS, as ... mm. Purification of the C-terminal domain of PS The cell lysate was passed through a DEAE anion exchange column. The protein was eluted with a linear gradient of NaCl (0–500 mm)...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt
... that is capable of binding several different families of transcriptional activators [30], and evidence indicates that the KIX domain has the ability to simultaneously interact with at least two ... indicated in blue. The location of the extended loop is indicated with an arrow. (B) The CBP–KIX domain : cMyb binary complex. The CBP–KIX domain is shown in orange and the...
Ngày tải lên: 16/02/2014, 14:20
Tài liệu Báo cáo khoa học : Bản chất của khủng hoảng kinh tế thế giới pdf
... hoang ba't ddng san d Hoa Ky. Bay gid ngUdi ta cho rang nguyen nhan cua ta't ca cac KH nay la sii dau cd cua cac ngan hang va cdng ty da qud'c gia de bu vao cai da ma't ... cac nfldc dang phat trien (A. Panagaraya, 2005): 1. Cac nUdc da phat trien bao ve bien gidi va trd cap rat cao. 2. Trd ca'p va bao ve ciia cac nUdc da phat trien ra't cd b...
Ngày tải lên: 17/02/2014, 05:20
Tài liệu Báo cáo khoa học: Oxidized elafin and trappin poorly inhibit the elastolytic activity of neutrophil elastase and proteinase 3 pdf
... Higuchi et al. [30] to obtain cDNAs encoding M25L–elafin and M63L–trap- pin. For this purpose, forward primers 5¢-CGACTCGA GAAAAGAGCGCAAGAGCCAGTCAA-3¢ and 5¢-CGAC TCGAGAAAAGAGCTGTCACGGGAGTTCCT-3¢ ... oxidized elafin and trappin. The data for the native inhibors are from Zani et al. [15]. The k diss and K i values are experimental, whereas the k ass values are calculated. MPO, myeloperox...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: Diversity and junction residues as hotspots of binding energy in an antibody neutralizing the dengue virus doc
... measured at the interface between a solid and a liquid phase, and cal- culated as the ratio of two rate constants. However, values of DDG and DDG¢ for mutant Fab fragments, calculated from values ... wells of a microtiter plate and the bound Fab4E11-H6 was revealed with a goat antibody, directed against mouse Fab and conjugated with alkaline phosphatase. The total concen...
Ngày tải lên: 19/02/2014, 07:20