Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf
... new family within this class. The amino acid sequence of its catalytic domain is approximately equidis- tant from those of all mammalian class I PDEs, the class I PDEs dunce of D. melanogaster,regAofD. ... TbPDE2 family. Outside of the catalytic domain, sequence similarity decrea- ses, within 10–40 amino acids at the N-terminal side of the domain, and within 15 amino acids...
Ngày tải lên: 19/02/2014, 12:20
... Biotin-TCGACTA GAAGCTTCTAGAAGCTTCTAG HSE antisense AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ... compilation ª 2009 FEBS TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding...
Ngày tải lên: 18/02/2014, 14:20
... Bio-Imaging analyzer BAS-2500 using IMAGE GAUGE V3.3 software. Chromatin and protein–DNA analysis Micrococcal nuclease (MNase) digestion and in situ cleavage by methidiumpropyl-EDTA–Fe(II) (MPE) was ... subnucleosomal bands are indicated. (B) Phosphorimager profiles of individual lanes from (A) , indicating changes in MNase digestion on treatment of oocytes with TA or TSA. Positions of t...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: "Translating a Unification Grammar with Disjunctions into Logical Constraints" pdf
... Translating a Unification Grammar with Disjunctions into Logical Constraints Mikio Nakano and Akira Shimazu* NTT Basic Research Laboratories 3-1 Morinosato-Wakamiya, Atsugi 243-0198 Japan ... rules, a set of lexical items, and a database. Each phrase structure role is a triplate ( V , ~, C /, where V is a variable, ~ is a list of variables, and C is a constraint on...
Ngày tải lên: 20/02/2014, 18:20
Tài liệu Báo cáo khoa học: Hypoxia-inducible factor-1a blocks differentiation of malignant gliomas pdf
... of HIF- 1a was significantly increased in parallel with increasing glioma grade (Fig. 7B). The percentage of HIF- 1a- positive cells in Grade I averaged 19.4%, while those in Grades II, III and IV ... differentiation. These phenomena all indicate the essential role of HIF- 1a in the negative regulation of differentiation in malignant gliomas. Interestingly, in contrast to their dif...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu Báo cáo khoa học: Phylogenetic relationships in class I of the superfamily of bacterial, fungal, and plant peroxidases pptx
... EHEC-strain catalase peroxidase (strain 0157:H7) Escherichia coli EuglgraAPX Q8LP26 Ascorbate peroxidase Euglena gracilis FraganaAPX O48919 Ascorbate peroxidase Fragaria x ananassa GaldparAPX Q8GT26 ... Arabidopsis thaliana ArathaAPXt Q42593 Ascorbate peroxidase (thylakoid) Arabidopsis thaliana ArchfulCP O28050 Catalase–peroxidase Archaeoglobus fulgidus AspefumCP Q7Z7W6 Catalase–peroxidase As...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: "Lexicographic Semirings for Exact Automata Encoding of Sequence Models" pdf
... to failure transitions in comparable situations. 2 The Lexicographic Semiring Weighted automata are automata in which the tran- sitions carry weight elements of a semiring (Kuich and Salomaa, ... described earlier, and represented in three ways: first as an approximation of a failure machine using epsilons instead of failure arcs; sec- ond as a correct failure machine; and third us...
Ngày tải lên: 20/02/2014, 04:20
Tài liệu Báo cáo khoa học: "Event Matching Using the Transitive Closure of Dependency Relations" pdf
... SIGIR 2005, Salvador, Brazil, August. Radu Florian, Hani Hassan, Abraham Ittycheriah, Hongyan Jing, Nanda Kambhatla, Xiaoqiang Luo, Nicholas Nicolov, and Salim Roukos. 2004. A statis- tical model ... phrase, a participial verb phrase or an entire indicative clause. For example, the fol- lowing are all possible event arguments: • the U.S. invasion of Iraq • Red Cross admitting Israeli an...
Ngày tải lên: 20/02/2014, 09:20
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf
... Miyazawa K, Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy- ama O, Takahashi K et al. (1989) Molecular cloning and sequence analysis of cDNA for human hepatocyte growth ... TTSP family, matriptase and hepsin. HAI-1 was originally identified as a potent inhibitor of hepatocyte growth factor acti- vator (HGFA), a blood coagulation factor XII-like seri...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx
... activate l-arginine, displaying 60% identity to the characterized A- domain of MycC. Interestingly, A 1 and A 4 inherit a highly identical (90%) specificity-determining residue pattern, leading to ... cluster gave rise to radiolabeled erythrochelin, which could be clearly identified on an analytical scale. The sensitivity of radioactivity detection and sophisti- cated analytical sepa...
Ngày tải lên: 16/02/2014, 09:20