Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

... enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth Amelia Smyk 1 , Magdalena Szuminska 1 , Katarzyna A. Uniewicz 1 , ... SKAR(E) GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC pYESTrp2 ⁄ PDIP46 ⁄ SKAR(F) GCGGGATCCCTGGACGGGCAGCCGATGAAG A...

Ngày tải lên: 19/02/2014, 05:20

... signals were determined by immunoblotting and by autoradiography as indicated. (B) The autoradiographic Cdc45 bands were quantified with the program PHORETIX 1D ADVANCED, and depicted in a graph. A B Fig. ... analysis of DNA polymerase d p125 and p50 subunits, PCNA and replication protein A p70 and p32 subunits in whole -cell lysates of serum-starved T98G cells....

Ngày tải lên: 19/02/2014, 00:20

... 5¢-TCATGCTGGTTGAGACTG GA-3¢ and 5¢-CCAGGTGTGGAGCAAGGCAG-3¢) and a 938 bp fragment of promoter 3 (primers, 5¢-CTCACAG CAGCCAGTAAGTG-3¢ and 5¢-ACTCACAGGCTCTGG GGCTG-3¢) were amplified using a Taq polymerase ... expressed in Neuro 2a cells (a and d) . Golgi apparatus was visualized using anti-Gogi p58 protein IgG 48 h after transfection (b and e). Merged images showed that...

Ngày tải lên: 19/02/2014, 06:20

... (67 kDa) and cytochrome c (CC, 12 kDa) are marked with arrows. Inset: SDS/PAGE of the isolated preparation. Coomassie stained lanes: 1, standards; 2, recombinant IF from plants. PAS stained lanes: ... for a long time [5,7]. The disease is caused by lack of IF and without treatment by injections of 1 mg of the vitamin at regular intervals this condition is lethal [8]. The m...

Ngày tải lên: 21/02/2014, 00:20

... from incorrect data present in corpora. In order to better understand what makes good evaluation data (and metrics), we designed and im- plemented an experiment in which human judges evaluated German string ... realisation system is developed, and not only globally, but also at the level of individual sentences. Another major consideration in evaluation is what to take as the gol...

Ngày tải lên: 22/02/2014, 02:20

... based on its characteristic retention time and the absorption spectrum of each retinoid standard. Isomerohydrolase activity was calculated from the area of the 11cROL and 13cROL peaks and expressed ... transcriptase sys- tem (Applied Biosystems Inc.) with an oligo-dT primer and random hexamer. To eliminate potential genomic DNA contamination, the RNA from the eyecups were trea...

Ngày tải lên: 14/02/2014, 14:20

... as a D , b D , and c D , respectively, and the a and b subunits of the reactivase are abbrevi- ated as a R and b R , respectively, molar ratios of a D , b D , c D , a R and b R in bands i and ... was incubated with the reactivase in the presence of ADP and Mg 2+ and followed by nondenaturing PAGE, the bands of the enzyme and the reactivase wer...

Ngày tải lên: 15/02/2014, 01:20

... indicated were treated with recombinant human TRAIL for 4 h and cell survival was assessed using the MTT assay. Cas- pase 3 activity was assessed by measuring degradation of the Ac-DEVD-pNA peptide. ... of intact Bid by Itch. This leads to the suggestion that removal of tBid by proteasomal degra- dation leads to an increase in Bid cleavage, resulting in the disappearance of bo...

Ngày tải lên: 16/02/2014, 09:20

... Universidade Cato ´ lica de Brası ´ lia, Brazil 6 Departamento de Biologia, Universidade Federal de Juiz de Fora, Brazil 7 Embrapa Arroz e Feija˜o, Goia ˆ nia, Brazil Introduction Plant–pathogen ... Filho H, Machado MA et al. (2003) Proteome analysis of the plant pathogen Xylella fas- tidiosa reveals major cellular and extracellular proteins and a peculiar codon bias distribution. Pro...

Ngày tải lên: 18/02/2014, 18:20

... tonozuka@cc.tuat.ac.jp *Present address Department of Chemistry and Material Engineering, Shinshu University, Nagano, Japan Database The atomic coordinates and structural fac- tors described in this ... maltodextrin-binding protein [21] and A. acidocaldarius maltose ⁄ maltodextrin-binding protein [22], was unsuccessful. Therefore, a MAD data collection of the SeMet derivative...

Ngày tải lên: 19/02/2014, 00:20