Tài liệu Báo cáo khoa học: Gene silencing at the nuclear periphery pdf
... that heterochromatin clusters at the nuclear periphery adjacent to the nuclear lamina, hinting that proteins of the lamina may participate in regulation of gene expression. Recent studies on the ... euchromatin at the nucleoplasm, and of gene- silenced condensed heterochromatin at the vicinity of the INM are circled. In the latter state, epigenetic modifications...
Ngày tải lên: 19/02/2014, 02:20
... embryo- genesis, all the evidence suggests that sex determination might disobey the conventional rules of evolutionary conservation. The common picture emerging here is that the genes at the top of the ... latipes). This Y-chromosomal gene is the product of a gene duplication of the autosomal dmrt1a gene and was designated dmrt1bY [8] or Dmy [9]. It was shown to be th...
Ngày tải lên: 14/02/2014, 19:20
... phosphodiesterase inhibitor. The homogenates were then deproteinated by heating in a boiling water bath for 10 min, followed by centrifugation at 15 000 g for 20 min at 4 °C to sediment denatured proteins. Supernatants ... in any of the BBMV samples (data not shown), indicating the absence of GLUT2 from the BBMVs and therefore any basolateral membrane contamination. To investigate...
Ngày tải lên: 21/02/2014, 00:20
Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt
... assist in the purification of the R2F-protein. In the new puri- fication strategy that was developed (see Materials and methods), an increase in the putative radical signal, relative to the overall ... in a French Press at 1500 p.s.i. The resulting homogenate was submitted to frac- tionated ammonium sulfate precipitation. Active RNR was found in the precipitate at 40–60% satur...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Transient silencing of Plasmodium falciparum bifunctional glucose-6-phosphate dehydrogenase) 6-phosphogluconolactonase docx
... TTTTGACAAGTCCAAATACCTCTTT CGGCCAACGTTAAAAAGTATCGGATGGAATTTTGGCCG PfGPx (PFL0595C) AATTGTGATTCGATGCATGATG TTTATCGACGAGAAATTTTCCAA CGGCCAACGTTAAAAAGTATCGGATGGAATTTTGGCCG Transient silencing of G6PD-6PGL ... TGACTACGTCCCTGCCCTT ACAATTCATCATATCTTTCAATCGG GGGGGACACCGCCCGTCGCTCCCCC PfGR (NC_004317) AGTGGAGGAATGGCTGCAG CCTAAACGGGATTTTTCGACA CGGGCAGCAAGGCATAACGCAAGCCCG PfTrxR (AL929357) TTGTACTAATA...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: Gene transcription of fgl2 in endothelial cells is controlled by Ets-1 and Oct-1 and requires the presence of both Sp1 and Sp3 pdf
... 5¢-GGGCTGCTTG AGGAAGTATAAGAAT-3¢;Stat3,5¢-GATCCTTCTG GGAATTCCTAGATC-3¢; and C/EBP, 5¢-TGCAGATT GGGCAATCTGCA-3¢ are from Santa Cruz Biotechno- logy. The binding reactions were size-fractionated on a nondenaturing, ... as template. Arrow indicates the nucleotide that is matched to the band present in the primer extension reaction on the right. The sequence of the primer is 5¢-CCTC...
Ngày tải lên: 20/02/2014, 11:20
Tài liệu Báo cáo khoa học: Crystal structure of the cambialistic superoxide dismutase from Aeropyrum pernix K1 – insights into the enzyme mechanism and stability pdf
... Sedimentation equilibrium distribution of ApeSOD. The line reflects the best fit of the data and indicates that the apparent molecular mass is 96 265 Da. The deviation between empirical data and the ... from the equatorial plane, and the coordination site is the same as that of the additional water molecule in the Fe-bound ApeSOD octahedral structure. Thus, it can be assum...
Ngày tải lên: 14/02/2014, 22:20
Tài liệu Báo cáo khoa học: Nucleolin/C23 mediates the antiapoptotic effect of heat shock protein 70 during oxidative stress pptx
... by the antisense oligonucleotide, the protection of Hsp70 is lost. Taken together, our results demonstrate an impor- tant relationship among the regulation of nucleo- lin ⁄ C23, the activation ... unknown. The aim of the current study was to investigate the potential involvement of nucleolin ⁄ C23 in the antiapoptotic mechanism of Hsp70. We found that primary cultures of neona...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học : Các phương thức thể hiện lời nói trên đài phát thanh docx
... ngudd khac mdt each thuc sy boat bat. Mat khac, khi doc vdn ban, ngudi dgc thudng khdng cd, hoac rat it cd su giao tiep vdd thinh gia, do thdn mat cua Idd ndi vi the cting giam di. De ban ... khdng the yen tam dya hoan toan vao cdc van ban viet sdn, ma da ed phuang thdc "kbdu ngu boa", bdt dau xuat hien nhting dng bien ngdn ngu linh hoat ban. Vi du, ngucd ndi ed...
Ngày tải lên: 17/02/2014, 05:20
Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf
... bearing either the wild-type or mutated binding site (Fig. 4B, C). These observations suggest that miR-23a binds mainly to the first targeting site of the IL6R mRNA 3¢ UTR and represses gene expression. ... expression. These data highlight the prediction that IL6R is a direct target of miR-23a. miR-23a negatively regulates IL6R expression at the mRNA and protein levels miRNAs can...
Ngày tải lên: 18/02/2014, 04:20