Tài liệu Báo cáo khoa học: Perturbation of membranes by the amyloid b-peptide – a molecular dynamics study pptx

... Conformational transition of the amyloid b-peptide. Proc Natl Acad Sci USA 102, 540 3–5 407. 25 Lemkul JA & Bevan DR (2008) A comparative molecu- lar dynamics analysis of the amyloid b-peptide ... order parameters of each leaflet separately, including the whole acyl chain and the ‘plateau region’ described above. Taking the approach applied by Bachar and Beck...

Ngày tải lên: 18/02/2014, 08:20

... pathway [47]. Caspase-9 is also cleaved by caspase-3 at another cleavage site. How- ever, this fragmentation does not have caspase activity. It enhances the activation of other caspases by alleviat- ing ... molecular mass oligonu- cleosomal DNA fragmentation [14]. In addition, caspases are a key mediator of DNA fragmentation. Caspases activate most apoptotic path- ways through...

Ngày tải lên: 14/02/2014, 22:20

... spectra at 300 K of NarG( 1–2 8) peptide in the absence (black trace) and in the presence (orange trace) of 2 molar ratio of NarJ. Fig. S2. Overlay of 1 H, 15 N-HSQC spectra at 300 K of NarJ (black) ... NarG( 1–2 8) consisted of an a- helix (residues 2–1 1) followed by an antiparallel pair of b-strands (residues 1 6–1 9 and 2 2–2 5). The N-terminal helix was...

Ngày tải lên: 16/02/2014, 14:20

... sequencing of the nano- ESI–qTOF and MALDI-TOF ⁄ TOF MS data followed by database matching (peaks protein id and spider) [86] was Tropoelastin degradation by elastinolytic MMPs A. Heinz et al. 1952 ... amino acid in tropoelastin and may also be influenced by the amino acid at P 1 ¢. As Ala and Gly constitute more than 50% of the tropoelastin sequence, it seems likely that the...

Ngày tải lên: 16/02/2014, 14:20

... TRAIL R2, and this then leads to recruitment of the adaptor protein Fas-associated death domain and the initiator caspases procaspase-8 and procaspase- 10, and formation of a membrane-bound multiprotein complex ... in U343 and U373 cells, there was no significant synergis- tic effect of TRAIL and gamma irradiation, indicating that the activation of DNA damage-induced signaling...

Ngày tải lên: 18/02/2014, 17:20

... native Pfu polymerase and vector pAC1 as the template. The following oligonucleotide primer was used: 5¢-CGTCCAGACATGGAGGcaaGGtACCCTCAACAC TAGC-3¢. Mismatches are indicated in lower case and the introduced ... chain with a single GlcNAc 2 Man 5 N-glycan (calculated molecular mass, 1217.1 Da). As with the wild-type Cel7B cat , a range of isoforms was observed by MS; those sep...

Ngày tải lên: 19/02/2014, 12:20

... Tripathy et al. and Herrmann-Frank et al. have found activation of the channel at 10 0–2 50 lm and inactivation at higher luminal calcium concentrations [15,16]. As the effect of the luminal cal- cium ... and Ma et al. [12]. Sitsapesan & Williams observed that the channel was only regulated by the luminal calcium if it was first pre- activated by ATP and cyclic ADP-ribo...

Ngày tải lên: 19/02/2014, 16:20

... of fragments containing the TATATAA sequence, but not by the mutated GATATCA sequence (Fig. 7A; lanes 3, 4, 6, 7 and 9). Inhibition by TATATAA-containing fragments was reversed by supplementation ... respectively); same fragment from which the TATATAA sequence was mutated to GATATCA (lanes 5 and 6, 10 and 100·, respectively). Regulation of pol III transcription A. Parthasarth...

Ngày tải lên: 20/02/2014, 02:21

... semantic analysis, and pragmatic analysis. Each stage has been designed to use linguistic data such as the lexicon and grammar, which are maintained separately from the engine, and can easily ... into our natural language understanding system. Client- server architecture was used to make a large volume of lexical information and a large knowledge base available to the syst...

Ngày tải lên: 20/02/2014, 18:20

... NA TGCARRAAYATHTTYTCCAG Deg RPE65-Rev AYRAAYTCRWRBCCYTTCCA RPE6 5a- Fwd NM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev ... GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC RPE65c-His-Fwd NM_001113653 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC Y. Takahashi et al. A no...

Ngày tải lên: 14/02/2014, 14:20