Tài liệu Báo cáo khoa học: Perturbation of membranes by the amyloid b-peptide – a molecular dynamics study pptx
Tài liệu Báo cáo khoa học: Perturbation of membranes by the amyloid b-peptide – a molecular dynamics study pptx
... Conformational transition of the amyloid b-peptide. Proc Natl Acad Sci USA 102, 540 3–5 407.25 Lemkul JA & Bevan DR (2008) A comparative molecu-lar dynamics analysis of the amyloid b-peptide ... order parameters of each leaflet separately,including the whole acyl chain and the ‘plateau region’described above. Taking the approach applied by Bachar and Becker [18], we analyzed the lipids ... Journal 276 (2009) 306 0–3 075 ª 2009 The Authors Journal compilation ª 2009 FEBS 3075 Perturbation of membranes by the amyloid b-peptide – a molecular dynamics study Justin A. Lemkul and David...
- 16
- 475
- 0
Tài liệu Báo cáo khoa học: Regulation of DNA fragmentation: the role of caspases and phosphorylation doc
... pathway [47]. Caspase-9 is alsocleaved by caspase-3 at another cleavage site. How-ever, this fragmentation does not have caspase activity.It enhances the activation of other caspases by alleviat-ing ... molecular mass oligonu-cleosomal DNA fragmentation [14].In addition, caspases are a key mediator of DNAfragmentation. Caspases activate most apoptotic path-ways through the cleavage of a wide range ... induced apop-tosis in HeLa cells. Toxicology 256, 11 8–1 27.17 Enari M, Sakahira H, Yokoyama H, Okawa K,Iwamatsu A & Nagata S (1998) A caspase-activatedDNase that degrades DNA during apoptosis,...
- 15
- 784
- 0
Tài liệu Báo cáo khoa học: Basis of recognition between the NarJ chaperone and the N-terminus of the NarG subunit from Escherichia coli nitrate reductase pdf
... spectra at 300 K of NarG( 1–2 8) peptide in the absence (black trace) and in the presence (orange trace) of 2 molar ratio of NarJ.Fig. S2. Overlay of 1H,15N-HSQC spectra at 300 K of NarJ (black) ... NarG( 1–2 8) consisted of an a- helix (residues 2–1 1) followed by an antiparallel pair of b-strands(residues 1 6–1 9 and 2 2–2 5). The N-terminal helix wassimilar to that observed in the NarG X-ray structure(rmsd ... binding, NarJ undergoes a conformational change The temperature dependence of the partial molar heatcapacity of free NarJ or NarJT differed considerablyfrom that of their complexes with NarG( 1–1 5)...
- 10
- 685
- 0
Tài liệu Báo cáo khoa học: Degradation of tropoelastin by matrix metalloproteinases – cleavage site specificities and release of matrikines pptx
... sequencing of the nano-ESI–qTOF and MALDI-TOF ⁄ TOF MS data followed by database matching (peaks protein id and spider) [86] wasTropoelastin degradation by elastinolytic MMPs A. Heinz et al.1952 ... amino acid in tropoelastin and may alsobe influenced by the amino acid at P1¢. As Ala andGly constitute more than 50% of the tropoelastinsequence, it seems likely that the nature of the aminoacid ... RV & Docherty AJ(1991) Matrix metalloproteinase degradation of elastin,type IV collagen and proteoglycan. A quantitative com-parison of the activities of 95 kDa and 72 kDa gelatin-ases,...
- 18
- 428
- 0
Tài liệu Báo cáo khoa học: Upregulation of DR5 by proteasome inhibitors potently sensitizes glioma cells to TRAIL-induced apoptosis doc
... TRAIL R2, and this then leads to recruitment of the adaptor protein Fas-associated death domainand the initiator caspases procaspase-8 and procaspase-10, and formation of a membrane-bound multiproteincomplex ... inU343 and U373 cells, there was no significant synergis-tic effect of TRAIL and gamma irradiation, indicatingthat the activation of DNA damage-induced signalingpathways was not sufficient to reactivate ... lines (datanot shown).As gamma irradiation is an existing component of current glioma therapies, and as activation of TRAILreceptors and DNA damage were shown to have syner-gistic death-inducing...
- 12
- 440
- 0
Tài liệu Báo cáo khóa học: Heterogeneity of homologously expressed Hypocrea jecorina (Trichoderma reesei ) Cel7B catalytic module pptx
... native Pfu polymerase and vector pAC1 as the template. The following oligonucleotide primer was used:5¢-CGTCCAGACATGGAGGcaaGGtACCCTCAACACTAGC-3¢. Mismatches are indicated in lower case and the introduced ... chain with a single GlcNAc2Man5N-glycan(calculated molecular mass, 1217.1 Da). As with the wild-type Cel7Bcat, a range of isoforms was observed by MS; those separated by 162 Da reflect variable ... Man5GlcNAc2(ManP)Man6GlcNAc242 133 Man5GlcNAc2(ManP)Man6GlcNAc2Hex42 295 Man7GlcNAc2(ManP)Man6GlcNAc242 374 (ManP)Man6GlcNAc2(ManP)Man6GlcNAc242 457 Man7GlcNAc2(ManP)Man6GlcNAc2HexFig....
- 11
- 414
- 0
Tài liệu Báo cáo khoa học: Effect of gadolinium on the ryanodine receptor/ sarcoplasmic reticulum calcium release channel of skeletal muscle docx
... Tripathy et al. and Herrmann-Franket al. have found activation of the channel at10 0–2 50 lm and inactivation at higher luminal calciumconcentrations [15,16]. As the effect of the luminal cal-cium ... and Ma et al. [12].Sitsapesan & Williams observed that the channel wasonly regulated by the luminal calcium if it was first pre-activated by ATP and cyclic ADP-ribose (cADPR) on the cis side ... presence of 2 lM gadolinium trans. The ratio of the Ponormvalues to the average of the Ponormvalues during oneexperiment was plotted against the holding potential. Data pointscould be satisfactory...
- 8
- 587
- 1
Tài liệu Báo cáo khoa học: Transcription of individual tRNA1Gly genes from within a multigene family is regulated by transcription factor TFIIIB pdf
... of fragments containing the TATATAA sequence, but not by the mutatedGATATCA sequence (Fig. 7A; lanes 3, 4, 6, 7 and 9).Inhibition by TATATAA-containing fragments wasreversed by supplementation ... respectively); same fragment from which the TATATAA sequence was mutated to GATATCA(lanes 5 and 6, 10 and 100·, respectively).Regulation of pol III transcription A. Parthasarthy and K. P. Gopinathan5194 ... shut off. By contrast, when there is demand forlarge excesses of a particular type of tRNA, as in the PSG, and sufficient quantities of transcription factorsare available, transcription from all...
- 15
- 484
- 0
Tài liệu Báo cáo khoa học: "Integration of Large-Scale Linguistic Resources in a Natural Language Understanding System" pdf
... semantic analysis, and pragmatic analysis. Each stage has been designed to use linguistic data such as the lexicon and grammar, which are maintained separately from the engine, and can easily ... into our natural language understanding system. Client- server architecture was used to make a large volume of lexical information and a large knowledge base available to the system at development ... for any real application, manual development could be a substantial task. Our linguistic servers are provided to greatly reduce the magnitude of that task. The servers contain the necessary...
- 5
- 416
- 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc
... NA TGCARRAAYATHTTYTCCAGDeg RPE65-Rev AYRAAYTCRWRBCCYTTCCARPE6 5a- FwdNM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACACRPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAGRPE65c-FwdNM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACACRPE65c-Rev ... GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. Takahashi et al. A novel isomerohydrolase in the retinaFEBS Journal 278 (2011) 291 3–2 926 ... CTGAGGTTACAGACAACTGTTC13cIMH GSP-Rev CCTTTGACATCGCAAGTGGATCARPE65c GSP-FwdNM_001113653 TTGAGGTGACAGACAATTGCCTRPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCGRPE6 5a- His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653...
- 14
- 753
- 0
Từ khóa: Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ