Tài liệu Báo cáo khoa học: Mouse recombinant protein C variants with enhanced membrane affinity and hyper-anticoagulant activity in mouse plasma pptx

Tài liệu Báo cáo khoa học: Mouse recombinant protein C variants with enhanced membrane affinity and hyper-anticoagulant activity in mouse plasma pptx

Tài liệu Báo cáo khoa học: Mouse recombinant protein C variants with enhanced membrane affinity and hyper-anticoagulant activity in mouse plasma pptx

... Morphological-Biomedical Sciences, University Hospital of Verona, Italy Introduction Protein C is a vitamin K-dependent c- carboxyglutamic acid-containing protein (Gla protein) found in human and mouse plasma ... recombinant protein C preparations were determined by SDS-PAGE followed by silver staining. Preparation of mouse activated protein C Incubation of mouse...

Ngày tải lên: 18/02/2014, 06:20

17 496 0
Tài liệu Báo cáo khóa học: A multi-protein complex containing cold shock domain (Y-box) and polypyrimidine tract binding proteins forms on the vascular endothelial growth factor mRNA Potential role in mRNA stabilization pptx

Tài liệu Báo cáo khóa học: A multi-protein complex containing cold shock domain (Y-box) and polypyrimidine tract binding proteins forms on the vascular endothelial growth factor mRNA Potential role in mRNA stabilization pptx

... 3B). To investigate the individual roles CSD and PTB proteins may play in directing CCV1 complex binding to the 5¢-ACCUCUU-3¢ and 5¢-UUUUCUU-3¢ sequences, recombinant CSD (GST-dbpB/YB-1) and PTB ... probes are derived from pGEM44 and pGEMV1, respectively. Cytoplasmic complexes CC44a and CCV1 and unbound RNA probe are indicated. (C) Cytoplasmic complexes CC44 and CCV1, in g...

Ngày tải lên: 19/02/2014, 12:20

13 604 0
Tài liệu Báo cáo khoa học: Regulation of connective tissue growth factor (CTGF/CCN2) gene transcription and mRNA stability in smooth muscle cells Involvement of RhoA GTPase and p38 MAP kinase and sensitivity to actin dynamics docx

Tài liệu Báo cáo khoa học: Regulation of connective tissue growth factor (CTGF/CCN2) gene transcription and mRNA stability in smooth muscle cells Involvement of RhoA GTPase and p38 MAP kinase and sensitivity to actin dynamics docx

... monomeric G-actin i s a critical determinant for CTGF/CCN2 gene induction. These data indicate that distinct cytoskeletally based signaling events within the intracellular signaling machinery affect ... G-actin inhibited CTGF/CC N2 gene induction, whereas F-actin enhanced CTGF/CCN2 gene express ion. F ourth, a ctin monomer-sequestering agents that mimic the physiologic G-actin-binding protei...

Ngày tải lên: 19/02/2014, 16:20

15 576 0
Tài liệu Báo cáo khoa học: Transient RNA–protein interactions in RNA folding docx

Tài liệu Báo cáo khoa học: Transient RNA–protein interactions in RNA folding docx

... the protein can bind to the RNA molecule when it has already adopted its correct structure, or the speci c binder can interact with the RNA during its folding process and can accel- erate folding ... [50,57–59] hint at the interaction between the proteins’ basic amino acids and the nucleic acid backbone via ionic forces. In fact, transient interactions are characterized mainly by l...

Ngày tải lên: 14/02/2014, 19:20

9 601 1
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

... artificial substrate myelin basic protein (MBP) but not GST (Fig. 4A). Although no kinase activity could be detected for PTI1-4 in vitro, incubating OXI1 with increasing amounts of PTI1-4 enhanced ... then examined how both proteins interact with MPK3 and MPK6 proteins. Results AGC kinases interact with PTI1 kinases in vitro To isolate other components of the OXI1 (AGC2-1) si...

Ngày tải lên: 14/02/2014, 19:20

11 701 0
Tài liệu Báo cáo khoa học: Degradation of tropoelastin by matrix metalloproteinases – cleavage site specificities and release of matrikines pptx

Tài liệu Báo cáo khoa học: Degradation of tropoelastin by matrix metalloproteinases – cleavage site specificities and release of matrikines pptx

... epithelial cells and processes various ECM constituents, such as collagens, gelatin, and laminin, and also non-ECM proteins, including pro-tumor necrosis factor-a and a 2 -macro- globulin [2]. MMP-9 ... mm; Dionex) and elution using a linear binary gradient: 5–65% ACN in 0.1% formic acid in 35 min, maintenance at 65% ACN for 10 min, and 65–5% ACN in 10 min. The typical opera...

Ngày tải lên: 16/02/2014, 14:20

18 428 0
Tài liệu Báo cáo khoa học: parDtoxin–antitoxin system of plasmid R1 – basic contributions, biotechnological applications and relationships with closely-related toxin–antitoxin systems ppt

Tài liệu Báo cáo khoa học: parDtoxin–antitoxin system of plasmid R1 – basic contributions, biotechnological applications and relationships with closely-related toxin–antitoxin systems ppt

... affecting RNA binding, whereas mutants affecting residues proposed to be involved in speci c RNA binding had a reduced binding activity but maintained a basic, although reduced, RNase activity. In ... of RNase A and RNase T1 and involves a catalytic acid, a catalytic base and a residue stabilizing the reaction intermediate. RNA binding occurs on a concatemeric RNA surface contai...

Ngày tải lên: 18/02/2014, 04:20

21 768 0
Tài liệu Báo cáo khoa học: The multicopper oxidase from the archaeon Pyrobaculum aerophilum shows nitrous oxide reductase activity docx

Tài liệu Báo cáo khoa học: The multicopper oxidase from the archaeon Pyrobaculum aerophilum shows nitrous oxide reductase activity docx

... vibrational modes in the low-frequency region, originating from the coupling of the Cu–S(Cys) stretch with the S C b – C a (Cys) bond, as typically observed in copper proteins containing a T1 site ... Purification of recombinant McoP produced in Escherichia coli. Fig. S1. SDS ⁄ PAGE analysis of McoP overproduction and purification. Fig. S2. CD spectrum in the far-UV region, refl...

Ngày tải lên: 18/02/2014, 04:20

14 642 0
Tài liệu Báo cáo khoa học: Novel aspects of heat shock factors: DNA recognition, chromatin modulation and gene expression ppt

Tài liệu Báo cáo khoa học: Novel aspects of heat shock factors: DNA recognition, chromatin modulation and gene expression ppt

... specificity may enable an HSF1–HSF2 heterotrimer to have a distinct HSE specificity. Binding of HSF to chromatin and changes in chromatin structure Packaging of DNA into nucleosome arrays, which can be ... unknown [10–12]. In addition, protein protein interactions with HSPs and other proteins can regulate the monomeric– trimeric transition of HSF in cells [2]. Transcription activa...

Ngày tải lên: 18/02/2014, 04:20

10 565 0
Tài liệu Báo cáo khoa học: The miRNA-192 ⁄194 cluster regulates the Period gene family and the circadian clock doc

Tài liệu Báo cáo khoa học: The miRNA-192 ⁄194 cluster regulates the Period gene family and the circadian clock doc

... sites which were gener- ated using the following primers: GGATGAACCTTCA TACCCTTTCCAAGACGAAAACAACAGACAGACCTT TTTAAGTCCTGGACTT, GAGCCCCAAACCTTAGCCT CATTTATTTTGTTCAAAACAATAAGTCATTTTCCCC TTAGAGTGCTTGAAGAA ... using the following primers: GGTAGCAGTCTGCATTCTTATGGCCATTAGAAAAA CAAAACTCCTTGCCTCTAAAGTCAGATCATGAA and GCCTCTGCCAGTGTCCCCAGCACTTTTCAAAACTTT GGACACTTGGGGAAAAGTGAGG. Luc-Per3-3¢UTR- Mut cont...

Ngày tải lên: 18/02/2014, 06:20

9 481 0
Từ khóa:
w