... shows that Cinnamomum longepetiolatum Costerm. apud Phamh. was a new natural source of camphor in Vietnam. Keywords: Cinnamomum longepetiolatum, Lauraceae, Essential oil, camphor. 1. Introduction ∗ ∗∗ ∗ ... Journal of Science, Natural Sciences and Technology 24 (2008) 211-213 211 A new natural source of Camphor from Cinnamomum longepetiolatu...
Ngày tải lên: 12/02/2014, 17:20
... [ 14 C]aminoacyl-tRNA (made in the pathway from 14 C-labeled amino acids), [ 3 H]aminoacyl-tRNA, 14 C- and 3 H-labeled protein were measured. The 3 Hin protein was insignificant, showing that the aminoacyl- tRNA ... channeling of aminoacyl-tRNA for protein synthesis. The cells were electroporated to facilitate entry of 3 H-labeled amino- acyl-tRNA and 14 C-labeled free amino acids. The...
Ngày tải lên: 19/02/2014, 18:20
Tài liệu Báo cáo khoa học: Transient silencing of Plasmodium falciparum bifunctional glucose-6-phosphate dehydrogenase) 6-phosphogluconolactonase docx
... (X74988) GAACTCCAGGAAAAACAAGTCAAG TTTTGACAAGTCCAAATACCTCTTT CGGCCAACGTTAAAAAGTATCGGATGGAATTTTGGCCG PfGPx (PFL0595C) AATTGTGATTCGATGCATGATG TTTATCGACGAGAAATTTTCCAA CGGCCAACGTTAAAAAGTATCGGATGGAATTTTGGCCG Transient ... (AL929357) TTGTACTAATATTCCTTCAATATTTGCTG GCCACGGGCGCTAATT CCGGGCTGTAGGAGACGTAGCTGAAAATGTCCCGG PfSOD (PF08–0071) CAACGCTGCTCAAATATGGA CATGAGGCTCACCACCACA CGCGCCTACTTTTTACTGGGATTCTA...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: Subproteomics analysis of Ca2+-binding proteins demonstrates decreased calsequestrin expression in dystrophic mouse skeletal muscle pdf
... steel tray. The tray was then placed on top of a hot plate and the temperature maintained at 9 0 °C for 5 min to aid the staining of protein spots. The tray was then placed on a laboratory shaker ... (Molecular D ynamics) with IMAGEQUANT V3.0 software. Results In order to determine the fate of the terminal cisternae Ca 2+ -binding protein, calsequestrin, and related luminal sarcop...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: "Structural Definition of Affixes from Multisyllable Words" docx
... c/t as in lac/tate m/b as in am/bition r/t as in fer/tile m/p as in am/pere p/t as in ap/titude r/l as in pur/loin r/b as in ar/bor n/d as in ban/dit and so on. Therefore, more difficulty in ... eliminate them at this point in the research. What is indicated, perhaps, is the structural classification of the weak suffixes by degree of weakness as a means of a...
Ngày tải lên: 19/02/2014, 19:20
Tài liệu Báo cáo khoa học: Functional dissection of the Schizosaccharomyces pombe Holliday junction resolvase Ydc2: in vivo role in mitochondrial DNA maintenance pptx
... region of Ydc2 (residues 1–35) contains a small putative DNA-binding SAP motif (after SAF -A/ B, Acinus and PIAS) associated with proteins involved in chromosomal organization and DNA repair [27]. In ... role of recombination in mtDNA inheritance in S. cerevisiae showed that budding cells were enriched in linear monomers of mtDNA. It was proposed that in addition to a ro...
Ngày tải lên: 20/02/2014, 11:20
Tài liệu Báo cáo khoa học: Regulatory modes of rod outer segment membrane guanylate cyclase differ in catalytic efficiency and Ca2+-sensitivity ppt
... Analysis of data was performed with ORIGIN 6.1 and SIGMA PLOT 4.2 software. A direct plot of activity vs. [GTP] gave in all cases a sigmoidal curve indicating cooperative substrate binding. In order ... Biochemical analysis of a dimerization domain mutation in RetGC-1 associated with dominant cone-rod dystrophy. Proc. Natl Acad. Sci. USA 96, 9039–9044. 16. Duda, T., Venkatar...
Ngày tải lên: 21/02/2014, 00:20
Tài liệu Báo cáo Y học: Structural determinants of the half-life and cleavage site preference in the autolytic inactivation of chymotrypsin pdf
... (Millipore). Determination of the autolytic inactivation rates The active enzymes were incubated in the assay buffer at 37 8C at a 1.0 m M initial concentration. For determining Table 2. Rate constants of autolytic ... fragments I and IV and the appearance of fragment II in the degradation of the Tyr146!His/Asn147!Ser mutant (panel d) indicated a significant decrease in the r...
Ngày tải lên: 22/02/2014, 07:20
Tài liệu Báo cáo khoa học: Solution structure of hirsutellin A – new insights into the active site and interacting interfaces of ribotoxins docx
... length of the N-terminal hairpin in HtA is intermediate between those in RNse T1 and a- sarcin, having 20 amino acids in HtA, 26 in a- sarcin and 12 in RNase T1. From a functional point of view, ... in HtA replaces a tyrosine of a- sarcin, and the aromatic ring of F126, close to the catalytic H113, replaces a leucine side chain in a- sarcin in a similar a...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Crystal structure of the catalytic domain of DESC1, a new member of the type II transmembrane serine proteinase family pptx
... rigid domain association for the N-terminal SEA domain with the back site of the proteinase domain. Abbreviations HAI, hepatocyte growth factor activator inhibitor; HAT, human airway trypsin; PAI-1, ... analysis of DESC1 suggests a possible rigid domain association between the N-terminal SEA domain and the back site of the proteinase domain. This interaction would fix the SEA domain i...
Ngày tải lên: 19/02/2014, 00:20