Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt
... 281 aaggaagctg agttggctgc tgccaccgct gagcaataac 320 321 tagcataccc cttggggcct ctaaacgggt cttgaggggt 360 361 TTTTTGCTGA AAGGAGGAAC TATATCCGGA TATCCCGCAA 400 401 GAGCCCGGCA GTACCGGCAT AACCAAGCCT ... gcagcgatgg cggcgtgtgc cgaaaattct 160 161 gaaaaaatgc cgccgcgata gcgattgccc gggcgcgtca 200 201 tttgccgcgg caacggctat tgcggctaac tcgagcccgg 240 241 gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 ... taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgattgcccgggcgcg I L K K C R R D S D C P G A acgtaaacggcgccgttgccgataacgccgattgagctcggc tgcatttgccgcggcaacggctattgcggctaactcgagccg...
- 9
- 497
- 0
Tài liệu Báo cáo khoa học: Catabolite repression in Escherichia coli – a comparison of modelling approaches docx
... exclusion,whereas phosphorylated EIIA activates adenylatecyclase (CyaA) and leads to an increase in the intra-cellular cyclic AMP (cAMP) level [1].Mathematical models of cataboliterepression in E. coli The ... molecular medicine. In systemsbiology, quantitative experimental data and mathe-matical models are combined in an attempt to obtaininformation on the dynamics and regulatory structures of the ... substrates using a mathematical model, and it wasshown that, in the case of non-PTS carbohydrates(carbohydrates that are not phosphorylated duringuptake, such as lactose or arabinose), a simple...
- 9
- 723
- 0
Tài liệu Báo cáo khoa học: Phylogenetic relationships in class I of the superfamily of bacterial, fungal, and plant peroxidases pptx
... Structural comparison of four representatives of class I of the superfamily of bacterial, fungal, and plant peroxidases. (A) N-terminal domain and (B) C-terminal domain of catalase–peroxidase from Haloarcula ... the parts coding for the N-terminal and C-terminal domains of the co rresponding genes (KatG) w ere t rea ted se pa rately. S eq uence data for Candida al bicans was o btained fromthe Stanford ... subbranch isparticularly interesting: the APX gene of a red algae(Galdieria partita) has a common origin with APXs fromgreen algae (Chlamydomonas sp. and Chlamydomonasreinhardtii) and all...
- 13
- 512
- 0
Tài liệu Báo cáo khoa học: Final steps in the catabolism of nicotine Deamination versus demethylation of c-N-methylaminobutyrate doc
... Use15¢-GAG GTG GAT CCG TGG GCC GCA-3¢ Forward mao, cloning 25¢-GAA TGA CTC GAG CCG AAG TAA TC-3¢ Reverse mao, cloning 35¢-CTT CTG AGG ATC CCA AAT GAC AGT-3¢ Forward sad, cloning 45¢-CAT GTA AGC CCC ... metabolites in the medium of A. nicotinovo-rans pAO1 and growth of A. nicotinovorans pAO1 and A. nicotino-vorans lacking pAO1 on CH3-4-aminobutyrate, 4-aminobutyrate and CH3NH2as carbon source. ... CH3-4-aminobutyrate and not 4-aminobutyrate was the substrate of the AO and thus both MABO and AO have the same substrateled us to postulate two pathways for the catabolism of CH3-4-aminobutyrate...
- 9
- 524
- 0
Tài liệu Báo cáo khoa học: Proteasome involvement in the degradation of the Gq family of Ga subunits pptx
... stimulation did notalter the degradation rate with 60 and 40% of the pro-tein remaining at 3 and 6 h, respectively, both for theligand-activated and nonactivated Gaq. Adding newmedia containing ... muscarinic recep-tor 1 (M1R) and Gaq, showed the characteristicincrease in accumulation of inositol phosphates. Lig- and- induced release of inositol phosphates was againmarkedly increased after ... encoding for M1R (A) and Gaq and GaqR183C (B), Ga16 and M2R (C), Ga16 and Ga16Q212L (D), as indicated. Cells were metabolically labeled, stimula-ted with carbachol (10 lM) as indicated...
- 13
- 465
- 0
Tài liệu Báo cáo khoa học: "Contrasting Multi-Lingual Prosodic Cues to Predict Verbal Feedback for Rapport" pptx
... manually created for the Span-ish and Arabic data. Manual annotation of a broadrange of nonverbal cues, including gaze, blink, headnod and tilt, fidget, and coverbal gestures, is under-way. ... task-oriented di-alog, identifying increases in pitch and intensity aswell as certain POS patterns as key contributors. In multi-lingual comparisons, (Ward and Tsukuhara,2000; Ward and Al Bayyari, 2007; ... et al., 2005), gaze (Watson, 1970),cues to vocal back-channel (Ward and Tsukuhara,2000; Ward and Al Bayyari, 2007; Rivera and Ward, 2007), nonverbal back-channel (Bertrand etal., 2007)), and...
- 6
- 286
- 0
Báo cáo khoa học: EspB from enterohaemorrhagic Escherichia coli is a natively partially folded protein pptx
... drawn only for visual assistance and is not a mathematical fit.Fig. 5. Urea unfolding of EspB at various pH values and at 20 °C. (A) The far-UV CD spectra obtained in the presence and absence of ... Honda4 and Itaru Yanagihara11 Department of Developmental Infectious Diseases, Research Institute, Osaka Medical Center for Maternal and Child Health, Japan2 Department of Biotechnology, Graduate ... Takahashi A, Yanagihara I, Akeda Y,Imura K, Kodama T, Kono G, Sato Y, Iida T &Honda T (2002) Cortactin is necessary for F-actinaccumulation in pedestal structure induced by entero-pathogenic...
- 13
- 437
- 0
Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt
... nrdF+ gene was sequenced by a primer walkingapproach. For DNA analysis, dnastar software (DNAS-TAR Inc., Madison, WI, USA) and clone manager 5.0(Scientific & Educational Software, Cary, ... (5¢-TTT TTC TAG AGC AGG GTA GGTTGA TTT CAT GTC GAA TG-3¢; additional XbaI siteunderlined) and OB 3 (5¢-AAA AGA ATT CTT AGAAGT CCC AGT CAT CGT C-3¢; additional EcoRI siteunderlined).The amplified ... Brukersoftware, as described above.Analysis of metalsManganese and iron have been determined by GF-AAS and ICP-MS. [As a result of problems with the protein matrix in the analysis of metalloproteins,...
- 14
- 872
- 0
Tài liệu Báo cáo khoa học: Nuclear receptors in the mosquito Aedes aegypti Annotation, hormonal regulation and expression profiling ppt
... group of nine fat bodies were collected and RNA lev-els were analyzed using qPCR. Transcript abundance values for AaEcRA, AaEcRB, AaUSP -A, AaUSP-B, AaE7 5A (A) , AaHR3, AaHR4, AaE78,AaHR39, AaHR78 ... to increase again at peak vitellogenesis(18 + 24 h PBM). These transcripts (AaUSP -A, AabFTZ-F 1A , AabFTZ-F1B, AaHR78, AaHNF- 4A, AaHNF-4B, AaHNF-4C, AaSvp and AaERR) werealso analyzed in our in ... analyzed, and Fig. 2 depicts the profilematching both replicates.An increase in transcript abundance for AaEcRA,AaEcRB, AaE7 5A, AaE75B, AaE75C, AaHR3,AaHR4, AaE78 and AaHR39 occurred in both...
- 22
- 578
- 0
Từ khóa: tài liệu báo cáo môn triếttài liệu báo cáo tài chínhtài liệu báo cáo môntài liệu báo cáo khoa họctài liệu báo cáo nghiên cứu khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015