the concept of mens rea in international criminal law the case for a unified approach
A STUDY ON THE USE OF PEER TEACHING IN ESP CLASSES AT THE COLLEGE OF SCIENCE, VIETNAM NATIONAL UNIVERSITY HANOI
... research’s aim is to examine the impact of ‘Peer-teaching’ on ESP teaching and learning quality, the collected data of the study was analyzed both quantitatively and qualitatively according to two facets: ... important since the alternative is a more instrumental peer teaching approach which often involves some form of credit or payment for the person acting in a teaching capacity thus losing a sense ... giving and receiving feedback and evaluating their own learning. Peer learning is becoming an increasingly important part of many courses, and it is being used in a variety of contexts and...
- 40
- 903
- 3
Báo cáo hóa học: " Research Article A Simulation Study: The Impact of Random and Realistic Mobility Models on the Performance of Bypass-AODV in Ad Hoc Wireless Networks" pdf
... repair the link break, the node broadcastsan RREQ for that destination. Otherwise, the node makes a list of unreachable destinations consisting of the unreachableneighbor and any additional ... the performance of the Bypass-AODV as well as the originalAODV.(1) The routing overhead ratio is the ratio of the amount in bytes of control packets transmitted to the amount in bytes of data ... discoverymechanism will start. Nevertheless, the routing overhead in Bypass-AODV experiences little increase relative to AODV,as shown in Figure 13. On the other hand, increasing the speed will increase...
- 10
- 604
- 0
Báo cáo lâm nghiệp: "Study of the properties of thirteen tropical wood species to improve the prediction of cutting forces in mode B" pptx
... database in Montpellier.3.3. Study of a statistical modelEach physical and mechanical characteristic not being ableto explain alone cutting forces involved during machining,their combination ... during machining. In fact, it appearedthat best results were obtained for a combination of specificTable VII. Variance analysis of the first model including interactions between factors: elasticity ... static, allowed a very good approximation of true woodbehaviour during machining. In fact, the unique parameter“Pf,I” is able to explain almost 70% of the variations of cuttingforces involved...
- 10
- 385
- 0
FORMS OF RESPONSIBILITY IN INTERNATIONAL CRIMINAL LAW International Criminal Law Practitioner Library Series Volume I doc
... ExtraordinaryChambers of the Courts of Cambodia (ECCC) and, of course, the International Criminal Court – are also examined. The law of the International Criminal Court, contained in its primary instruments ... assist in ascertaining the elements of aiding and abetting in customary international law, the Trial Chamber engaged in a detailed analysis of a number of post-Second World War cases adjudicated ... responsibility that has no trueparallel in domestic criminal law. 11Indeed, as domestic and international avenues for international criminal adjudication proliferate, and regional and international politics...
- 462
- 478
- 1
The Power of Video Technology in International Comparative Research in Education pot
... practitioners. International videotapes serve as a record of teaching in a par-ticular time and place, and make that teaching available for multiplereexaminations; they facilitate collaboration among ... in turn, meant that little can INTERNATIONAL COMPARATIVE RESEARCH IN EDUCATION 13grating qualitative and quantitative analysis. Several noted that the challenge of reconciling qualitative and ... SciencesNational Academy of EngineeringInstitute of MedicineNational Research Council MAKING EDUCATION STANDARDS INTERNATIONALLY COMPETITIVE viiPreface The Board on International Comparative Studies in...
- 44
- 290
- 0
Guide to the Master of Science (MSc) in International and Monetary Economics pptx
... up an excellent national and international reputation in these fields. The two institutions also complement each other in terms of both staff and subject matter: their areas of research and approaches ... opportunities for graduates of the program may be found, for example, in the following areas: ã macroeconomic analysis in central or commercial banks, ã official bodies (e.g. tax or finance authorities), ... who are familiar with the issues in the international economy. The recurring crises in financial markets, and their implications for economies in general, show how important the functioning of...
- 7
- 455
- 0
Tài liệu GUILTY PLEAS IN INTERNATIONAL CRIMINAL LAW ppt
... place at the ICTY, the ICTR, and the Special Panels, and they examine, among other things, the nature of the bargaining that has occurred, the rationales used to justify that bargaining, the ... “ [a] gainst great odds” that the Security Coun-cil did eventually create the ICTY. e road to the creation of an international tribunal for Rwanda featured sim-ilar obstacles. In the span ... cre-ation of the ICTR. e creation of the ad hoc tribunals for Rwanda and the former Yugoslavia helped to restart the on-again, o -again negotiations regarding a permanent S3857.indb...
- 379
- 1,076
- 0
Tài liệu Báo cáo khoa học: Effect of deletion of the DNase I hypersensitive sites on the transcription of chicken Ig-b gene and on the maintenance of active chromatin state in the Ig-b locus docx
... the Ig-b gene butunnecessary for the maintenance of the active chromatinstate in the Ig-b locus. In transient transfection assays, the DNA fragmentcontaining a DHS at )2.1 kb shows no enhancingactivity ... level of the core histones and a chromatin state in the flankingregion resistant to DNase I [1]. In this case, the forma-tion of cell type-specific DHS again does not occur in the context of a DNase ... pro-moters and enhancers but also are likely to participate in the establishment and maintenance of an activechromatin state [18,28,29]. In addition to their pres-ence in and adjacent to active...
- 11
- 638
- 0
Báo cáo khoa học: Limited mutagenesis increases the stability of human carboxypeptidase U (TAFIa) and demonstrates the importance of CPU stability over proCPU concentration in down-regulating fibrinolysis doc
... (tgctctagagcggccgcgggatgaagctttgcagccttgcagtccttgtacc); reverse: C-HIS1-rev (atgatgatgcttatcgtcatcgtccccgggctcgagaacattcctaatga catgccaagc) and C-HIS2rev (cggggtaccttattaagatccactatgatgatgatgatgatgatgatgct tatcgtcatcgtcc). The ... GateCPUfor(ggggacaagtttgtacaaaaaagcaggcttcaccatgaagctttgcagcc ttgcagtccttgtacc); Reverse: C-HIS1rev and C-HIS2rev and Gate-HISrev (ggggaccactttgtacaagaaagctgggtcctaagatccactatgatgatgatgatgatgatgatg). The resulting PCR fragments ... substrates, and determined the Kmconstants of native CPU from plasma, recom-binant WT CPU and YQ CPU for Hip-Arg and bra-dykinin using an arginine kinase-based kinetic assay[27]. Data are presented...
- 15
- 397
- 0
Báo cáo khoa học: Endosomal proteolysis of diphtheria toxin without toxin translocation into the cytosol of rat liver in vivo pdf
... and extends thisphysiological location of DT to the lysosomal appara-tus of insensitive cells.Comparable to the endosomal degradation of inter-nalized ricin A- chain in macrophages [30], the ... Journal compilation ê 2008 FEBS 1709 Fig. 1. Kinetics of the appearance of DT and mDT in the endo-lysosomal apparatus after toxin administration. (A) EN were isolated at the indicated times after ... Molecular mass markers are indicated to the left of each blot. Arrows to the right indicate the mobilities of intact (90 kDa) or truncated furin (70 kDa).T. El Hage et al. Activation and translocation...
- 15
- 195
- 0
Effect of Na2SO4 additive in positive electrodes on the performance of sealed lead-acid cells for electric scooter applications ppt
... crystal size in the formed plates and has a 2larger surface area. Increasing the amount of Na SO24additive to the positive electrode will not decrease the crystal size appreciably. The Na SO additive ... surfacearea and cause higher initial capacity and average capacityper cycle for both testing methods: the standard cycletesting and the ES driving pattern cycle testing. The initialand average ... leading to a lower capacitybecause of the smaller surface area. The additive Na SO24 in the positive electrode material can reduce the 4BScrystal size, which has a larger surface area and increasethe...
- 10
- 522
- 0
Báo cáo khoa học: "The influence of seed age on germinative response to the effects of fire in Pinus pinaster, Pinus radiata and Eucalyptus globulus" doc
... clearly defined germination peaks. In both P. pinaster and P. radiata most of the treat-ments place the peaks of maximum germination betweendays 7 and 25. These peaks are sharper in P. radiata ... percentage data was transformedusing an Arc-sine Transformation, and the average ger-mination time data using the log (mean germinationtime). The Test of Tukey [40] was used to analyse the dif-ferences ... 1990 and 1992 had very low germination val-ues for the same treatments. For the Temperature andTemperature + Ash treatments, germination rates nearlyalways increased as seed age decreased.Tree...
- 10
- 334
- 0
Báo cáo y học: "Most recent developments in strategies to reduce the progression of structural changes in osteoarthritis: today and tomorrow" doc
... composed of at least three main and distinct signalling pathways: the extracellular signal-regulated protein kinases, the c-Junamino-terminal kinases or stress-activated protein kinases,and the ... is an interesting target in the context of OA for at leasttwo main reasons. First, NO and its byproducts are able toinduce the inflammatory component of OA; NO can increase the activity of ... plays a central role in OApathophysiology. Factors that regulate its synthesis and/oractivity are therefore favoured targets. Other approaches arebroader and include activating or increasing...
- 14
- 420
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25