give a critical analysis of the concept of self defence in public international law and international humanitarian law
DICKIE’S INSTITUTIONAL THEORY AND THE “OPENNESS” OF THE CONCEPT OF ART pptx
Ngày tải lên :
23/03/2014, 13:20
... fact that a great number of philosophers, since the time of Plato up to our own day,
have attempted to give a “correct” enunciation of the nature of art. They have notably
maintained that art ... that the failure of Dickie’s
institutional definition, which is certainly one of the most plausible candidates for carrying out
the traditional project of Aesthetics in the contemporary era, can ... legitimately make us sceptical
about the possibility of giving a substantial definition of art that would at the same time take
into account contemporary artworks in all their variety. The second...
- 8
- 695
- 0
Báo cáo khoa học: Fluorescence studies of the replication initiator protein RepA in complex with operator and iteron sequences and free in solution pdf
Ngày tải lên :
07/03/2014, 04:20
... available, indicating secondary struc-
tural changes in the linker connecting the dimerization
and DNA-binding domains, and rearrangement of the
relative orientation of the two domains [7,9]. The ... 1A) , indicating that the secondary
structure is not affected by the mutation or by
AEDANS labeling. Thermal denaturation analysis of
the protein variants suggests a lower stability of the
mutant ... with the half site also
present in the operator in bold).
Name Length (bp) Sequence
1IR 39 GAACAAGGACAGGGCATTGACTTGTCCCTGTCCCTTAAT
1DR 45 ATACCC
GGGTTTAAAGGGGACAGATTCAGGCTGTTATCCACACCC
1DR-short...
- 15
- 431
- 0
The Role Of The United States Postal Service In Public Safety And Security doc
Ngày tải lên :
30/03/2014, 13:20
... Safety and Security Training. USPS training is aimed at
detecting and preventing mail crime, ensuring the security of the mail,
and maintaining public safety. e safety and security of the mail at ... risk of increase for certain types of mail crime in particular,
suspicious or hazardous incidents involving the mail.
Summary
Currently, the USPS and IS are doing much in the area of training ... JUSTICE
EDUCATION
ENERGY AND ENVIRONMENT
HEALTH AND HEALTH CARE
INTERNATIONAL AFFAIRS
NATIONAL SECURITY
POPULATION AND AGING
PUBLIC SAFETY
SCIENCE AND TECHNOLOGY
SUBSTANCE ABUSE
TERRORISM AND
HOMELAND...
- 221
- 397
- 0
Báo cáo y học: "A prospective observational study of the relationship of critical illness associated hyperglycaemia in medical ICU patients and subsequent development of type 2 diabetes"
Ngày tải lên :
25/10/2012, 10:02
... guidelines
for the management of patients with unstable angina and non-ST-
segment elevation myocardial infarction. A report of the American
College of Cardiology/American Heart Association Task ... statistical anal-
yses. Categorical data are presented as absolute and
relative frequencies, continuous variables as median with
inter-quartile range (IQR). Since distribution of data of
the continuous ... shock); ii) acute coronary syndrome (myocardial
infarction and unstable angina); and iii) all other admis-
sion diagnoses. This division was made due to the fact
that sepsis and acute coronary syndromes...
- 8
- 656
- 1
Báo cáo y học: " Laugh Yourself into a Healthier Person: A Cross Cultural Analysis of the Effects of Varying Levels of Laughter on Health"
Ngày tải lên :
26/10/2012, 09:57
...
Hunaid Hasan
, Tasneem Fatema Hasan
Mahatma Gandhi Mission’s Medical College, Aurangabad, Maharastra, India, 431003
Correspondence to: Hunaid Hasan or Tasneem Fatema Hasan, “Ezzi Manzil”, ... No. 3910, Near Bombay Mercantile
Bank, Beside Amodi Complex, City Chowk, Juna Bazaar, Aurangabad, Maharashtra, India 431001. Email:
hunaidhasan@hotmail.com or zainabhasan52@hotmail.com. Phone: ... of 730 participants between
the ages of eighteen and thirty-nine years. 366 participants were from Aurangabad, India
(AUR), and 364 participants were from Mississauga, Canada (MISS). The participants...
- 12
- 757
- 0
Tài liệu Psychometric properties of the quality of life scale Child Health and Illness Profile-Child Edition in a combined analysis of five atomoxetine trials pdf
Ngày tải lên :
12/02/2014, 19:20
... rather than the domains of the CHIP-
CE when evaluating ADHD patients. This is supported by
the factor analysis based on the sub-domains and the
correlation analysis of the sub-domains, which ... deleted. The
TA domain and the AP sub-domains were sensitive to
Table 2 Spearman’s correlation coefficients with 95% CIs between the sub-domains and the domains and between the domains and the total
score ... alpha
(standardized) for the sub-
domains and the lowest alpha
that was reached by deleting an
item in that sub-domain with
95% CIs
Sub-domains At baseline At endpoint For change from
baseline to...
- 15
- 1.2K
- 0
Tài liệu University Oars Being a Critical Enquiry Into the After Health of the Men Who Rowed in the Oxford and Cambridge Boat-Race, from the Year 1829 to 1869, Based on the Personal Experience of the Rowers Themselves pdf
Ngày tải lên :
14/02/2014, 21:20
... fullest
particulars regarding victors and vanquished, and there
are champions of the oar and the cricket-field whose
achievements are more familiar to the rising genera-
tion than those of any general, statesman, ... Whether the training and
exertion demanded of those who take part in the Uni-
versity Boat-Race are of so trying a character that in
numerous instances the constitution is liable to be per-
manently ... became rather stiff till after the race,
and then severe inflammation set in, in the elbow-joint,
followed by abscesses; and, after three months in bed,
pieces of bone came away, and I had the...
- 419
- 541
- 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
Ngày tải lên :
19/02/2014, 17:20
... CP-pyk
(5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT
GACANNNNNNNNNNNNNNTGRTATAATNNNNAA
GTAATAAAATATTCGGAGGAATTTTGAAATGAATA
AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk-
back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG
TC-3¢) ... (5¢-TGGTACTCGAG
CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG
AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and
downstream to pyk using primer pyk3 (5¢-GGAAGGA
TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4
(5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) ... pattern. By coregulating
PK and LDH cells can maintain homolactic fermenta-
tion.
The fact that the effects of PK and LDH almost
cancel each other out may also add to the explanation
of why the...
- 12
- 616
- 0
Tài liệu A PRELIMINARY ANALYSIS OF THE EFFECTS OF HR 2454 ON U.S. AGRICULTURE doc
Ngày tải lên :
21/02/2014, 01:20
... analysis does not assess the change in
farm income due to the Renewable Electricity Standard and other provisions in HR 2454 that
increase the demand for biomass and could provide additional ... grassland). Figure 4 shows the regional breakout of the potential carbon
dioxide equivalent sequestered through afforestation on cropland and pastureland and through
soil management at a carbon ... the impacts of House-passed climate
legislation, HR 2454, on U.S. agriculture. The analysis assumes no technological change, no
alteration of inputs in agriculture, and no increase in demand for...
- 13
- 651
- 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
Ngày tải lên :
07/03/2014, 14:20
... However, the mechanistic roles of several of
these residues are not described well and there is no example
of mutational analysis of all of these residues in the same
enzyme.
To obtain an insight into ... 4.2–
8.0 range, and a marked increase in K
m
at alkaline pH
(Table 2, Fig. 3).
The D215N and D140N mutants displayed an acidic
shift in the pH-activity profiles, whereas the Y214F and
the E144Q mutants ... enzyme that, at least in part,
results from the vicinity of Asp215 (Table 3, rows 1 and
4). The calculations indicate that the pK
a
of Glu144 is
further, and somewhat drastically, increased upon...
- 10
- 651
- 0
Báo cáo khoa học: "Analysis and Synthesis of the Distribution of Consonants over Languages: A Complex Network Approach" pptx
Ngày tải lên :
08/03/2014, 02:21
... the x-axis denotes the degree of each
node expressed as a fraction of the maximum de-
gree and the y-axis denotes the number of nodes
having a given degree expressed as a fraction of
the total ... pages (Adamic and Huberman, 2000) and so
on. Thus our inferences, detailed out in the next
section, mainly centers around this power law be-
havior.
3 Inferences Drawn from the Analysis of
PlaNet
In ... large networks is governed by robust self-
organizing phenomena that go beyond the particu-
lars of the individual systems.
Inspired by their work and the empirical as well
as the mathematical...
- 8
- 550
- 0
Báo cáo Y học: A comparative biochemical and structural analysis of the intracellular chorismate mutase (Rv0948c) from Mycobacterium tuberculosis H37Rv and the secreted chorismate mutase (y2828) from Yersinia pestis pptx
Ngày tải lên :
17/03/2014, 17:20
... EDTA, and 100 mm NaCl.
Fig. 1. Alignment of 90-MtCM with AroQ
a
CMs. The alignment begins with amino acid 13 in 90-MtCM (the numbering begins with amino
acid 1 in the 90 amino acid protein). Amino ... of
the two chains in the structure, which has a dimer in
the asymmetric unit, and in the file 2D8E, which has
one chain in the asymmetric unit, all of the C-terminal
residues are seen. Another difference ... is a malate ion
from the buffer in the active site of the enzyme. Malate
mimics endo-oxabicyclic dicarboxylic acid, the transition
state analog (TSA), in much the same fashion as citrate
that...
- 12
- 513
- 0
A Comparative Analysis of the Financing of HIV/AIDS Programmes docx
Ngày tải lên :
22/03/2014, 18:20
... HIV/AIDS-related activities. As mentioned, the
two main sources of funding are the Ministry of Finance and Planning and donors. The
Ministry of Finance and Planning allocates resources (as part of ... Hospital) and, through the provincial directorates of finance, to provincial
administration and from these to the district administration and/ or health facilities.
Financing of HIV/AIDS is mainly ... South Africa,
Swaziland and Zimbabwe. These countries
account for a third of PLWHA in sub-
Saharan Africa compared to a tenth of the
region’s population.
The high level of financing in Botswana,...
- 63
- 312
- 0
A Comparative Analysis of the Financing of HIV_AIDS Programmes doc
Ngày tải lên :
30/03/2014, 07:20
... Maziya – Swaziland
•Brian Chandiwana – Zimbabwe
The Departments of Treasury/Finance and the Departments of Health in the six countries
played an important role in the provision of information, without ... central agencies (e.g., Ministry of Health and Maputo
Central Hospital) and, through the provincial directorates of finance, to provincial
administration and from these to the district administration ... sources of information were Ministries of Finance/National Treasuries, Ministries
of Planning, Ministries of Health, Tax Offices, National Income Accounts and National
Health Accounts, income/employment...
- 63
- 322
- 0
A Comparative Analysis of the Financing of HIV_AIDS Programmes potx
Ngày tải lên :
30/03/2014, 07:20
...
None of the countries studied have undertaken a ‘National HIV/AIDS Accounts’, as has
been done in other countries such as: Rwanda, Argentina, Brazil, and other Latin
American and Caribbean countries. ... programmes.
Although most of the National Integrated Programme activities are based around the
Department of Health, it is anticipated that in the next two to three years administration
of the National ... report.
Another data limitation was the paucity
of information on household (and
business) expenditure on HIV/AIDS.
Estimates from Latin American and
Caribbean countries found that average
annual...
- 63
- 328
- 0
- telling the tale of the rise of the novel
- narrative of the execution of the queen of scots
- describe the cause of the war of the spanish succession
- justify the introduction of the concept of sustainability in tourism development
- what is the role of the president of the uk supreme court
- the war of the end of the world book review
- history of the translation of the book of mormon
- the execution of the queen of the scots
- marx law of the tendency of the rate of profit to fall
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2