0

changes in sewer lines and areas of septic system return flow simulated in a hypothetical scenario of increased withdrawals and discharges scenario 2 in the assabet river basin eastern massachusetts

báo cáo khoa học:

báo cáo khoa học: " Release kinetics of VEGF165 from a collagen matrix and structural matrix changes in a circulation model" pot

Báo cáo khoa học

... 3D models as a reasonable amendment in craniofacial reconstruction that offers multiple advantages They facilitate surgical planning by demonstrating the anatomical characteristics of the tissue ... providing them with a better understanding of the process and its possible outcomes Virtual planning and the use of rapid prototyping have been used mainly in craniomaxillofacial surgery Because of ... University, Aachen, Germany Authors’ contributions BL was responsible for a part of the operation and drafted the manuscript LP was responsible for the planning and manufacturing of the templates and the...
  • 4
  • 273
  • 0
báo cáo khoa học:

báo cáo khoa học: " Release kinetics of VEGF165 from a collagen matrix and structural matrix changes in a circulation model" pptx

Báo cáo khoa học

... UJ, JK and CF conceived of the study, and participated in its design and coordination and helped to draft the manuscript CF and UJ were involved in revising the article All authors read and approved ... Herlyn M: Vascular endothelial growth factor is a marker of tumor invasion and metastasis in squamous cell carcinomas of the head and neck Clin Cancer Res 1999, 5:775-7 82 Schliephake H, Jamil M, ... cytokine in the process of endochondral bone development and mediating bone vascularisation for normal differentiation of chondrocytes and osteoblasts An increase in VEGF is an indication of increased...
  • 7
  • 208
  • 0
Working PaPer SerieS no 1273 / DeCeMBer 2010: intereSt rate effeCtS of DeMograPhiC ChangeS in a neW-keyneSian life-CyCle fraMeWork pptx

Working PaPer SerieS no 1273 / DeCeMBer 2010: intereSt rate effeCtS of DeMograPhiC ChangeS in a neW-keyneSian life-CyCle fraMeWork pptx

Ngân hàng - Tín dụng

... (20 07) are in the tradition of Auerbach and Kotliko (1987), while Batini et al (20 06) uses a large-scale extension of Blanchard (1985), assuming that agents face a constant probability of death ... 4.1 Calibration We calibrate the system of steady-state equations to match key features of annual euro area data, taking, in particular, recent demographic observations until 20 08 as a benchmark, ... area in 20 08 10 The benchmark calibration reproduces euro area data listed in the column for the year 20 08 of the summary table ‘Main demographic and macroeconomic assumptions’ for the euro area...
  • 49
  • 455
  • 0
Soil microbial indices as bioindicators of environmental changes in a poplar plantation pot

Soil microbial indices as bioindicators of environmental changes in a poplar plantation pot

Nông nghiệp

... conditions 2. 4 Statistical analysis Analysis of variance (ANOVA) was performed to evaluate the main effects of FACE, fertilization, time and their interaction on parameters analyzed Data were tested ... NaOH and determined by titration of the excess NaOH with 0.1 M HCl (Badalucco et al., 19 92) The CO2 evolved during the 10th day of incubation was used as the basal respiration value because, after ... equilibrate at room temperature in the dark for day prior to biochemical analyses 2. 3 Chemical and microbiological analyses Inorganic nitrogen was assessed as the sum of ammonium and nitrate: ammonium...
  • 9
  • 265
  • 0
Báo cáo khoa học: Local binding with globally distributed changes in a small protease inhibitor upon enzyme binding ppt

Báo cáo khoa học: Local binding with globally distributed changes in a small protease inhibitor upon enzyme binding ppt

Báo cáo khoa học

... conformational rearrangements The former is analyzed as the dynamics of the molecule is investigated at pH in the free state The data show that there are changes in the R2 rates although the general ... respectively), being spatially far from the primary binding site, exhibit remarkable changes, Thr9 and Arg18 being the most prominent examples (Fig 3B) Relaxation data Relaxation parameters (T1, T2 and heteronuclear ... findings indicate that inhibitors of the pacifastin family have a special design bringing together the dynamical features of peptides and structural organization, i.e specific binding sites, of larger...
  • 12
  • 396
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Carbon stock changes in a peaty gley soil profile after afforestation with Sitka spruce (Picea sitchensis)" potx

Báo cáo khoa học

... and mineral layer (A) In the case of forest Soil carbon changes after afforestation stands and the clearfelled site, the OF layer was included with the OH layer In the unplanted grassland the ... concentrations in the mineral horizons of a slash pine chronosequence (stand ages between and 34 years old) in Florida Afforestation on natural grassland, clearfelling and replanting also caused changes in ... amount of litterfall increased [31] A linear accumulation of organic matter with stand age in the forest floor (OL and OF+ H layers) was found in slash pine plantations in Florida [7] In the 30-yr...
  • 8
  • 378
  • 0
Báo cáo y học:

Báo cáo y học: "Are there any changes in burden and management of communicable diseases in areas affected by Cyclone Nargis" pptx

Báo cáo khoa học

... 62% in urban areas and to 48% in rural areas in the months of 20 08 following the Nargis incident In urban and rural areas combined, the sanitary latrine coverage for the Nargis-affected population ... diseases such as malaria and dengue cases decreased significantly in 20 09, compared to 20 07 and 20 08 As shown in Figure 1, there was a significant peak in malaria cases in 20 07 but more of a typical ... contrast, the mortality percentage among malaria inpatients (case fatality rate among malaria inpatients) increased, rising from 1.16% in 20 07 to 3.31% in 20 09 It was shown, however, that malaria...
  • 11
  • 438
  • 0
Characteristics of Leachate from Citrus Groves and their Changes in the Collecting Reservoirs in Matsuyama, Japan

Characteristics of Leachate from Citrus Groves and their Changes in the Collecting Reservoirs in Matsuyama, Japan

Môi trường

... through the cultivation and the ratio of the increased amount of SS to the increased amount of Chl .a was higher than that of the algae Increased amount of SS were higher in the cases of high nitrate ... Osaka, Kobe, Hiroshima, and others Therefore, it is considered that a large amount of pollutants runs into the sea from the urban as well as industrial areas As the area around the Seto Inland ... surveyed in detail and material balances around reservoirs were considered RESEARCH PROCEDURE Location: Matsuyama region and periphery of the Seto Inland Sea The location of the research area and the...
  • 10
  • 717
  • 0
Tài liệu Reporting Corrections of Errors and Changes in Accounting Principles - Amending SFFAS No. 7, Accounting for Revenue and Other Financing Sources pdf

Tài liệu Reporting Corrections of Errors and Changes in Accounting Principles - Amending SFFAS No. 7, Accounting for Revenue and Other Financing Sources pdf

Kế toán - Kiểm toán

... modification The Board publishes adopted standards in a Statement of Federal Financial Accounting Standards Additional background information is available from the FASAB: • “Memorandum of Understanding ... Understanding among the General Accounting Office, the Department of the Treasury, and the Office of Management and Budget, on Federal Government Accounting Standards and a Federal Accounting Standards ... THE FEDERAL ACCOUNTING STANDARDS ADVISORY BOARD The Federal Accounting Standards Advisory Board (FASAB or the Board”) was established by the Secretary of the Treasury, the Director of the Office...
  • 14
  • 520
  • 0
Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx

Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx

Báo cáo khoa học

... creatine phosphokinase and 100 lM each of 20 L-amino acids The reaction was initiated by the addition of 20 0 lCiÆmL)1 of [32P]UTP (400 CiÆmmol)1) and was allowed to proceed for 45 at 33 °C Aliquots ... O2) and hypoxia (1 Torr O2) for 10 h was carried out using [a- 32P]UTP as described in Materials and methods Rate of 32P incorporation in the RNA fraction was determined as described before [21 ] ... hypoxia on the steady state levels of nuclear genome encoded CytOX IV and Vb mRNAs There was no change in the levels of these mRNAs in macrophages at h of hypoxia, the time point at which there was...
  • 9
  • 554
  • 0
Tài liệu Báo cáo khoa học: Moult cycle-related changes in biological activity of moult-inhibiting hormone (MIH) and crustacean hyperglycaemic hormone (CHH) in the crab, Carcinus maenas From target to transcript ppt

Tài liệu Báo cáo khoa học: Moult cycle-related changes in biological activity of moult-inhibiting hormone (MIH) and crustacean hyperglycaemic hormone (CHH) in the crab, Carcinus maenas From target to transcript ppt

Báo cáo khoa học

... GCCATGCTAGCAATCATCACCGTAG GTTGAGATCTGTTGTTTACTTCTTC GAGTTATCAACGACGAGTGTCC GAGACGACAAGGCTCAGTCC AAAGGTTTCCTCCACCCTGT ACTTCCTCGAGCTTGTCACG GACTTGGAGCACGTGTGT TATTGGTCAAACTCGTCCAT AAGACAGGAATGGCGAGT ... collected using baited traps in the Menai Strait, UK, and maintained in a recirculating seawater system under ambient conditions MIH and CHH were purified from sinus gland extracts by HPLC and quantified ... 30 Kotlyar, S., Weirauch, D., Paulsen, R.S & Towle, D.W (20 00) Expression of arginine kinase enzymatic activity and mRNA in gills of the euryhaline crabs Carcinus maenas and Callinectes sapidus...
  • 9
  • 587
  • 0
LONG TERM CHANGES IN VOTING POWER AND CONTROL STRUCTURE FOLLOWING THE UNIFICATION OF DUAL CLASS SHARES pdf

LONG TERM CHANGES IN VOTING POWER AND CONTROL STRUCTURE FOLLOWING THE UNIFICATION OF DUAL CLASS SHARES pdf

Quản trị kinh doanh

... Ding and Anil Markandya: The Economic Valuation of Marine Ecosystems Andreas Madestam: Informal Finance: A Theory of Moneylenders Efthymia Kyriakopoulou and Anastasios Xepapadeas: Environmental ... in a Speculative Market: The Chinese Split-Share Reform Angelo Antoci, Fabio Sabatini and Mauro Sodini: The Fragility of Social Capital Alexander Golub, Sabine Fuss, Jana Szolgayova and Michael ... Joyeeta Gupta: Sharing the Burden of Adaptation Financing: An Assessment of the Contributions of Countries Stefania Tonin, Anna Alberini and Margherita Turvani: The Value of Reducing Cancer Risks at...
  • 46
  • 354
  • 0
Báo cáo khoa học: Local changes in the catalytic site of mammalian histidine decarboxylase can affect its global conformation and stability pptx

Báo cáo khoa học: Local changes in the catalytic site of mammalian histidine decarboxylase can affect its global conformation and stability pptx

Báo cáo khoa học

... & Kagamiyama, H (20 03) Conformational change in aspartate aminotransferase on substrate binding induces strain in the catalytic group and enhances catalysis J Biol Chem 27 8, 9481–9488 48 Hayashi, ... transaldimination can occur, so that an enamine form of the product can either leave the catalytic site or react again with the internal aldimine to form a PLPadduct covalently attached to the catalytic ... fact, after min, the spectra of the HisOMe-treated samples had stabilized with the 390-nm peak as the major and final one In the reaction in the presence of an excess of the natural substrate histidine,...
  • 12
  • 409
  • 0
Comparision between background concentration of arsenic in urban and non urban areas of florida

Comparision between background concentration of arsenic in urban and non urban areas of florida

Môi trường

... background, and contaminated arsenic concentrations is more discernible in urban areas than in non-urban areas (Fig 2) There is a greater possibility of finding contaminated areas in urban environments ... demonstrated by Tiller (19 92) in a similar background study in Australian urban areas Tiller (19 92) avoided areas whose historical land-uses increase their probability of being contaminated In spite ... non-urban areas (ns448) in Florida centrations in non-urban areas surrounding the two cities and land-use categories analyzed within the two urban areas The distributions of arsenic concentrations in...
  • 10
  • 650
  • 0
Báo cáo khoa học: Functional analysis of two divalent metal-dependent regulatory genes dmdR1 and dmdR2 in Streptomyces coelicolor and proteome changes in deletion mutants ppt

Báo cáo khoa học: Functional analysis of two divalent metal-dependent regulatory genes dmdR1 and dmdR2 in Streptomyces coelicolor and proteome changes in deletion mutants ppt

Báo cáo khoa học

... DNAÆprotein interaction and of domain in the protein dimerization and metal binding (see the Discussion) There are important differences between DmdR1 and DmdR2 proteins in a Pro- and Ala-rich eight amino ... PCC79 42 is a DNAbinding hemoprotein Linkage of the Dps and bacterioferritin protein families J Biol Chem 27 0, 22 478 22 4 82 Loprasert S, Whangsuk W, Sallabhan R & Mongkolsuk S (20 04) DpsA protects the ... family (A) Note the strong conservation (amino acids shown as white on black) of domains and 2, and (B) the presence of an Ala- and Pro-rich segment inserted in domain of the S coelicolor DmdR2 protein...
  • 11
  • 315
  • 0
An application of GIS and Remote Sensing for Analysis of Agricultural Development-Induced Changes in Land Use: A case study in Lao PDR pdf

An application of GIS and Remote Sensing for Analysis of Agricultural Development-Induced Changes in Land Use: A case study in Lao PDR pdf

Lâm nghiệp

... and than this place was changed in dynamics way of land use systemThe forest area was destroyed by increasingly shifting cultivation and rubber plantation areas • Lack of an appropriate tool ... Statement of Problems • After 1999, the landscape in the study area has been changed cause of policy implementation such as rubber plantation and irrigation system were installed in the area, and ... images 345, and 2ndvi7 in the1 999 and 20 04 – classified to 11 classes • Create zone by overlaid three physical data (Ground data, GIS data and image classification) The area is located in the...
  • 24
  • 897
  • 0
Báo cáo khoa học: Crystal structures of HIV protease V82A and L90M mutants reveal changes in the indinavir-binding site potx

Báo cáo khoa học: Crystal structures of HIV protease V82A and L90M mutants reveal changes in the indinavir-binding site potx

Báo cáo khoa học

... van der Waals contacts with indinavir, of 3.8 A In PRV8 2A, the change in the position of the main chain atoms placed the Cb atom of Ala 82 within reasonable van ˚ der Waals distance of indinavir ... from the indinavir, and the side chain of Met90 and Met90¢ had altered interactions with the catalytic Asp25 and Asp25¢ However, there is a new polar interaction between the pyridyl N5 of indinavir ... that the asymmetrical interaction of indinavir O2 with the catalytic aspartates is associated with the short van der Waals interaction of the Met90/90¢ side chains with the carbonyl oxygen of Asp25 /25 ¢...
  • 9
  • 355
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Automatic training of lemmatization rules that handle morphological changes in pre-, in- and suffixes alike" docx

Báo cáo khoa học

... data The evaluation was carried out by dividing the available material in training data and test data in seven different ratios, setting aside between 1.54% and 98.56% as training data and the ... points The rules are counted after training with 1.54 percent of the available data and then repeatedly doubling to 3.08, 6.16, 12. 32, 24 .64, 49 .28 and 98.56 percent of the available data The data ... the training algorithm creates a 2 3 table (see Table 2) that counts the number of training pairs that the candidate lemmatizes correctly or incorrectly or that the candidate does not match The...
  • 9
  • 372
  • 0
Báo cáo khoa học: Calcium-dependent protein–protein interactions induce changes in proximity relationships of Cys48 and Cys64 in chicken skeletal troponin I ppt

Báo cáo khoa học: Calcium-dependent protein–protein interactions induce changes in proximity relationships of Cys48 and Cys64 in chicken skeletal troponin I ppt

Báo cáo khoa học

... binding to the ternary complex of TnI–TnC–TnT In addition, the amino acid sequences of skeletal and cardiac TnC and TnI are different [19 ,23 26 ], in particular, at their binding interfaces These ... TnI58)1 82 was incorporated into the troponin complex there was a Ca2+dependence of actomyosin ATPase activity that was essentially the same as that seen in the presence of intact TnI [44] As shown in ... sequence of the N-terminus of TnI (residues 1–30) that retains full biological activity to bind the C-terminal domain of TnC [49], and showed that the N- and C-terminal domains of TnI act as a Ca2+-dependent...
  • 9
  • 339
  • 0

Xem thêm