... -Connectedness 21 set of free homotopy classes of unoriented simple closed curves on T As we have discussed in the first chapter, there are one- one correspondence between these pairs of concepts ... essential simple closed curves on the punctured torus T Besides both bijections with Q ∪ {∞}, there is also a direct one- one correspondence between Ω, the set of complementary regions, and C, the set ... are connnected by semi-circles of radius 21 Each integer is a Farey neighbour of ∞ = 01 and hence, a +c connected to ∞ by a vertical straight line As the inductive step, we obtain b+d a c from...
Ngày tải lên: 16/10/2015, 15:35
... Nội dung giảng Bài 1: C Sharp kiến tr c NET C# Bài 2: Lập trình hướng đối tượng C# Bài 3: Lập trình nâng cao C# Bài 4: C c lớp C# Bài 5: Windows Application Bài 6: Truy c p liệu với NET Bài 7: ... Professional C# , Second Edition http://www.asp.net http://www.microsoft.com/net/default.mspx http://www.codeproject.com Slide nguồn tài liệu tham khảo download tr c tiếp http://www.vtportal.net/nghien-cuu-phattrien/thang-long/tab.aspx ... Nội dung môn h c Nắm ngôn ngữ lập trình C# (C Sharp) Hiểu kiến tr c NET Microsoft Triển khai số ứng dụng NET Framewrok (bài tập) Tiếp c n số hướng lập trình với NET (tùy chọn) Editor: Đoàn...
Ngày tải lên: 23/12/2013, 04:16
Pioneer Introduces the New CYBER NAVI Car Navigation system in Japan With the world’s first* Head-Up Display to project augmented reality information in front of the windscreen* pot
... Data Communication Module with a communication function that can be used free of charge for three years*5 The AVIC-VH99HUD, AVIC-ZH99HUD, AVIC-VH99CS and AVIC-ZH99CS models come with a Data Communication ... Scouter Mode This product is only for use with the AVIC-VH99 and AVIC-ZH99 models, which not come with a Cruise Scouter unit *11: This unit can also be used with AVIC-VH09CS, AVIC-ZH09CS, AVIC-VH09, ... which enables the AR HUD View This product is for use with the AVIC-VH99CS, AVIC-ZH99CS, AVIC-VH99, and AVIC-ZH99 models, which not come with an AR HUD unit*11 2)ND-CS2 Cruise Scouter unit, which...
Ngày tải lên: 07/03/2014, 11:20
Báo cáo khoa học: Interaction of synthetic peptides corresponding to hepatitis G virus (HGV/GBV-C) E2 structural protein with phospholipid vesicles doc
... phospholipid vesicles Biochemistry 23, 6072– 6077 Lakowicz JR (1983) Principles of fluorescence spectroscopy In Principles of Fluorescence Spectroscopy, pp 257–301 Plenum Press, New York Plasencia I, Rivas ... mm Tris ⁄ HCl buffer, pH 8.0, containing 70 mm calcein LUVs were prepared as described above, and nonencapsulated calcein was removed by gel filtration on a Sephadex G-100 column Calcein leakage ... dichroism spectroscopic data Nucleic Acids Res 32, W668–W673 33 Chen YH, Yang JT & Martinez HM (1972) Determination of the secondary structures of proteins by circular dichroism and optical rotatory...
Ngày tải lên: 07/03/2014, 17:20
five russian plays with one from the ukrainian (the babylonian captivity by lesya ukrainka). new york, 1916
Ngày tải lên: 04/06/2014, 17:29
báo cáo hóa học: "Reliability and validity of pendulum test measures of spasticity obtained with the Polhemus tracking system from patients with chronic stroke" pot
... traces for all subjects are presented in Figure Table summarizes the ICCs associated with the various pendulum test measures obtained from the traces With the exception of the ICC associated with ... Nurse, Cancer Research UK Your research papers will be: available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived ... http://www.jneuroengrehab.com/content/6/1/30 Table 2: Intraclass correlation coefficients (ICCs) for repeated pendulum test measures Measure ICC (p) 95% Confidence Interval Lower Upper First Reversal (no weight): affected side 956 (.001)...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học: "The New Jersey Institute of Technology Robot-Assisted Virtual Rehabilitation (NJIT-RAVR) system for children with cerebral palsy: a feasibility study " docx
... positioned gimbal Subject using a ringin Leckey Chair interfaced with the Haptic Subject positioned in Leckey Chair interfaced with the Haptic Master using a ring gimbal http://www.jneuroengrehab.com/content/6/1/40 ... environments Collisions with the tables, shelves and other cups provide tactile feedback and actual physical task constraints which provide for feedback and feed-forward processes after the subject acclimates ... Explosion, b) Cup Reach, c) Falling Objects, d) Hammer, and e) Car Race contact with the cup handle (Figure 2b) The participant uses their virtual hand to lift the virtual cup and place it onto...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo hóa học: "Research Article A Fourth-Order Boundary Value Problem with One-Sided Nagumo Condition" ppt
... − A , b Bλ : λ B − cu d 3.30 Boundary Value Problems Observe that L has a compact inverse Therefore, we can consider the completely continuous operator Tλ : C3 0, , Ê −→ C3 0, , Ê 3.31 given ... and u computations with t0 replaced by yield a contradiction For λ ∈ 0, , by 3.11 , we get the Boundary Value Problems following contradiction: λ λ au − A ≥ ar1 − A > b b 0≥u 3.17 The case t0 ... matique, Facult´ des Sciences, Universit´ Catholique de Louvain, F´ vrier 1994 e e e e e C de Coster and P Habets, “Upper and lower solutions in the theory of ODE boundary value problems: classical...
Ngày tải lên: 21/06/2014, 05:20
báo cáo hóa học:" The asymptotics of eigenvalues and trace formula of operator associated with one singular problem" potx
... asymptpotics of eigenvalues and trace formula of operator associated with one singular problem Nigar M Aslanova Institute of Mathematics and Mechanics of NAS of Azerbaijan, Baku, Azerbaijan Mathematics ... detailed discussions of the subject refer to [11] The asymptotic formula for eigenvalues of L0 and L One could easily show that under conditions A > E, A−1 ∈ σ∞ , the spectrum of L0 is discrete Suppose ... following asymptotic is true λm,k = γk + αm , αm = cm + O m3 (1.11) For large |z| consider the rectangular contour l with vertices at the points ±iB, AN ± iB, AN = 3πN 9π + which bypasses the origin...
Ngày tải lên: 21/06/2014, 17:20
Báo cáo hóa học: "Research Article Alternative Speech Communication System for Persons with Severe Speech Disord" pptx
... 3.1 Acadian French Corpus of Pathologic Speech To assess the performance of the system that we propose to reduce SSD effects, we use an Acadian French corpus of pathologic speech that we have collected ... Mel-Frequency cepstral coefficients (MFCCs) and cepstral pseudoenergy are calculated for all utterances and used as parameters to train and test the system [8] In our experiments, 12 MFCCs were calculated ... frequencies of occurrence of phonemes across the sentences reflect the distribution of phonemes found in reference corpora of French spoken in theatre productions; for example, /a/, /r/, and schwa...
Ngày tải lên: 21/06/2014, 20:20
báo cáo hóa học:" The asymptotics of eigenvalues and trace formula of operator associated with one singular problem" doc
... asymptpotics of eigenvalues and trace formula of operator associated with one singular problem Nigar M Aslanova Institute of Mathematics and Mechanics of NAS of Azerbaijan, Baku, Azerbaijan Mathematics ... detailed discussions of the subject refer to [11] The asymptotic formula for eigenvalues of L0 and L One could easily show that under conditions A > E, A−1 ∈ σ∞ , the spectrum of L0 is discrete Suppose ... following asymptotic is true λm,k = γk + αm , αm = cm + O m3 (1.11) For large |z| consider the rectangular contour l with vertices at the points ±iB, AN ± iB, AN = 3πN 9π + which bypasses the origin...
Ngày tải lên: 21/06/2014, 20:20
Báo cáo hóa học: " New Method to Prepare Mitomycin C Loaded PLA-Nanoparticles with High Drug Entrapment Efficiency" docx
... the corresponding physical mixture (Fig 1c and Fig 2c) , which suggests that MMC could not be solubilized effectively within DCM by simple physical mixing with SPC As MMC cannot be soluble in DCM ... the complex (Fig 3c) The spectrum of the physical mixture shows an additive effect of MMC and SPC, in which the characteristic absorption peaks of MMC (Fig 3a) at 3345 cm-1, 3316 cm-1, 3269 cm-1 ... PLA–MMC microparticles is found to be -12.6 mV This significant difference of zeta potential value between PLA–MMC–SPC nanoparticles and PLA– MMC microparticles can be explained by the fact that SPC...
Ngày tải lên: 22/06/2014, 00:20
Báo cáo hóa học: " Maximum MIMO System Mutual Information with Antenna Selection and Interference" docx
... the trace in (15) can be written as trace[U(Ω)2 UH AU(Ω)2 UH A] = trace[UΩUH AU(Ω)2 UH AUΩUH ] = trace[BBH ] since trace [CD] = trace [DC] [13] We see trace[BBH ] must be nonnegative since the ... matrix channel,” in Proc IEEE Int Conf Acoustics, Speech, Signal Processing, pp 2785–2788, Istanbul, Turkey, June 2000 [7] A F Molisch, M Z Win, and J H Winters, “Capacity of MIMO systems with ... Chair in electrical engineering His research interests include signal detection and estimation and related topics in the areas of signal processing and communications He is currently an Associate...
Ngày tải lên: 23/06/2014, 01:20
learning c# by developing games with unity 3d
... Working with objects is a class act Using Dot Syntax in a script Accessing a Component's own variables and methods Time for action – accessing a variable in the current Component Accessing another Component ... another Component on the current GameObject Time for action – communicating with another Component on the Main Camera Accessing other GameObjects and their Components Time for action – creating ... Free Access for Packt account holders If you have an account with Packt at www.PacktPub.com, you can use this to access PacktLib today and view nine entirely free books Simply use your login credentials...
Ngày tải lên: 01/08/2014, 16:59
Báo cáo toán học: "Hilbert space operators with one dimensional self-commutators " pptx
Ngày tải lên: 05/08/2014, 15:21
Báo cáo khoa học: "Immunohistochemical study of constitutive neuronal and inducible nitric oxide synthase in the central nervous system of goat with natural listeriosis" potx
... selected midbrains, L monocytogenes was confirmed by immunohistochemistry using the antisera described below Neither direct culture of bacteria nor cold enrichment culture were always successful ... inflammatory microabscesses Counterstained with hematoxylin Magnification: ×132 C: Immunohistochemical staining of inducible NOS in the caprine brain with natural listeriosis shows that iNOS immunoreactivity ... immunoreactivity was seen in some inflammatory cells Some cells show the typical morphology of macrophages in perivascular cuffs and microabscesses Counterstained with hematoxylin, Magnification:...
Ngày tải lên: 07/08/2014, 14:23
Báo cáo toán học: "Necklace bisection with one cut less than needed" pptx
... necklace bisection theorem Indeed, if we have beads of k colors and we can use k cuts then we can apply Corollary by adding a fictitious extra color and choosing D1 to contain only this new color ... language of necklaces and thieves this has the following consequence We use the phrase necklace bisection with the same meaning as in [2], i.e., it is a collection of cuts together with a bipartition ... unit vector in the direction of the ith coordinate axis We consider these 2(h + 1) vertices to be in one- to -one correspondence with the sets ±Ai so that v j corresponds to Aj and −v j corresponds...
Ngày tải lên: 07/08/2014, 15:22
Báo cáo y học: "The ITGAV rs3738919-C allele is associated with rheumatoid arthritis in the European Caucasian population: a family-based study" docx
... 5'-AAGTTGCCAACGTTCCGCGTTGCA-3' and antisense, 5'-GTAGTAGAAGATGGTCCTATCCACG-3' for SNP1; and sense, 5'ATTTCCAGGTGGAACTTCTTTTGGA-3' and antisense, 5'TCACAATTCAGATTTTTGCCACTGG-3' for SNP2 PCR amplification ... effects could be expected to be stronger RA factors that remain to be discovered Since the association evidence is modest, no genetic testing would be clinically indicated Instead, the clinical relevance ... single nucleotide polymorphism in sample of rheumatoid arthritis trio families Genotype Rheumatoid arthritis cases Controls P C/ C 33 39 0.4 (C/ C versus C/ A + A/A) C/ A 57 40 0.09 (C/ C + C/ A versus...
Ngày tải lên: 09/08/2014, 10:20
Báo cáo y học: "Differential expression of interferon-induced microRNAs in patients with chronic hepatitis C virus infection treated with pegylated interferon alpha" potx
... (forward primer, 5’-CTGCCTGGCAGAAAACTTACC-3’; reverse primer, 5’-CTCTGTTATTCTCTGGTGAGTCT CCTT-3’; probe, 5’CATCACACATATCTGTAAATCTC TGCCCCTGTTAGA-3’) Co-amplification of the betaglucuronidase gene ... http://www.virologyj.com/content/7/1/311 Page of Table Demographic and clinical characteristics of patients with chronic hepatitis C Patient Sex Age no HCV GT* Baseline weeks 4-weeks 12 weeks 12Ribavirin HCV-RNA ... performing selection of patients with CHC and analysing of clinical data; JV was responsible for performing selection of patients with CHC and analysis of clinical data; CS was responsible for executing...
Ngày tải lên: 12/08/2014, 02:20
Báo cáo y học: "Serum levels of autoantibodies against C-reactive protein correlate with renal disease activity and response to therapy in lupus nephritis" pps
... antibodies, CRP interacts with cellular Fcγ receptors, thereby facilitating the phagocytic clearance of circulating opsonized material Activation of the classical complement pathway is considered one ... Solid-phase classical complement activation by C- reactive protein (CRP) is inhibited by fluid-phase CRP -C1 q interaction Biochem Biophys Res Commun 2007, 352:251-258 Carlucci F, Terence Cook H, Garg ... enhance binding of circulating soluble immune complexes to phagocytic Fcγ receptors [12,43] and constitute a vicious circle Conclusions We have demonstrated a statistically significant correlation between...
Ngày tải lên: 12/08/2014, 11:22