... bốn loại: - Toàn (hay thuỷ tổ) - Vạn - a - Đơn a/ Tếbàogốctoànhaytếbàogốcthủytổ (totipotent stem cells) ∗ Là tếbào có khả biệt h a thành tất loại tếbào thể từ tếbào ban đầu ∗ Trứng ... nuôi cấy so với tếbàogốc phôi chúng giai đoạn biệt h a cao B Nguồn lấy tếbàogốc ∗ Nguồn lấy tếbàogốc phôi ∗ Nguồn lấy tếbào mầm phôi tếbàogốc thai ∗ 3.Nguồn lấy tếbàogốc trưởng thành ... - Tếbàogốc trưởng thành a/ Tếbàogốc phôi (Embryonic stem cells- ESCs) tếbào mầm phôi (Embryonic germ cells) ∗ Tếbàogốc phôi tếbàogốc vạn lấy từ phôi giai đoạn sớm (4-7 ngày tuổi) ∗ Tế...
... thấy tếbàogốctổ chức phôi, bào thai cá thể trởng thành Những tếbàogốc có nguồn gốc khác nh tếbàogốc phôi (bao gồm tếbàogốc từ phôi tếbào mầm từ tổ chức bào thai) tếbàogốc cá thể trởng ... tếbào máu tuần hoàn mang marker khác với tếbào gan, tuỷ xơng bào thai máu cuống rốn - Tếbàogốcbào thai tếbào mầm bào thai: từ 1985 có nhiều nghiên cứu thu đợc tếbào tiền thân dòng tếbào ... nh tếbàogốc tạo tếbào (myoblast), tếbàogốc tạo xơng (osteoblast) tếbàogốctếbào thần kinh vi tóm lại Nghiên cứu tếbàogốc cho biết thể đợc hình thành, phát triển từ tếbào nh tế bào...
... amplify the truncated form of MsrA and introduce a BamHI cutting site at the 3’ end (MsrA-for: 5’-cctggctgcggaggtggagaaac and MsrA-BamHI-rev: 5’-tggggccaaggatccgctttgaaagaacc) The amplicons were ... the total RNA extracted from cultured embryonic stemcells using the primer pairs of: MsrA-for: 5’-cctggctgcggaggtggagaaac and MsrA-rev: 5’-atggccatcgggcaggaaactcc The 744bp DNA band was gel ... 5’-AGGTATTGCTGGTGGTAGTCTTC; Amplicon size: 395bp MsrA-truncated-for: 5’CGACCCGACCCAAGGTTCTTTCA; MsrA-truncated-rev: 5’-GCCATCGGGCAGGAA ACTCCAG; Amplicon size:168bp b-actin-for: 5’-CCACTGCCGCATCCTCTTCCTC; b-actin-for:...
... MTT absorbance values obtained after exposure, with the initial absorbance reading for the unexposed physiological control maintained at 37oC Raw absorbance values obtained for % survival MTT assay ... serial passages Their appearance was virtually indistinguishable from non-temperature exposed hESC (data not shown) Chromosomal Analysis of hESC after exposure to low temperature Metaphase spreads ... cells were washed off prior to the MTT assay From the raw absorbance values, the survival rate was computed by a simple formula based on reference to the initial absorbance value obtained for the...
... biệt hoá thành tếbàogốc máu tếbàogốc máu tự nhiên chuột chết hoàn toàn trình chiếu xạ Như vậy, với thành công này, nhóm nghiên cứu chứng minh thay tếbào bị chết thể tếbàogốc Mong muốn TS ... hoá thành tếbào chuyên biệt (vẫn giữ đặc điểm ban đầu) Đây công đoạn khó khăn Tếbào trì từ vài tháng tới năm để xác định xem có thật tếbàogốchay không có phải dòng tếbào ổn định hay không ... chục tếbàogốc ban đầu tách từ phôi nhân nuôi thành hàng vạn tếbào theo quy trình đặc biệt Kết kiểm tra hình thái tếbào chất thị hoá mô chứng minh tếbào tách từ phôi chuột tếbàogốc Trước...
... essential for de novo methylation and mammalian development Cell 99, 247–257 33 Tsumura A, Hayakawa T, Kumaki Y, Takebayashi S, Sakaue M, Matsuoka C, Shimotohno K, Ishikawa F, Li E, Ueda HR et al ... K, Abe T, Nakano T, Asami T, Ebisuzaki T, Held WA, Yoshida S & Nagase H (2003) Global methylation screening in the Arabidopsis thaliana and Mus musculus genome: applications of virtual image ... Martins-Silva J & Saldanha C (2003) Multidisciplinary utilization of dimethyl sulfoxide: pharmacological, cellular, and molecular aspects Biochem Pharmacol 65, 1035–1041 19 Wakayama T & Yanagimachi...
... deoxyribonuclease (DNase I, amplification grade; TaKaRa, Kyoto, Japan) Microarray analysis and data mining (Aligent array) A one-color microarray-based gene expression analysis system (Agilent Technologies, ... 247–256 Sato Y, Araki H, Kato J, Nakamura K, Kawano Y, Kobune M, Sato T, Miyanishi K, Takayama T, Takahashi M et al (2005) Human mesenchymal stemcells xenografted directly to rat liver are differentiated ... regulated by differential roles of Cdc42 and Rac1 Dev Cell 7, 425–438 33 Hatada I, Fukasawa M, Kimura M, Morita S, Yamada K, Yoshikawa T, Yamanaka S, Endo C, Sakurada A, Sato M et al (2006) Genome-wide...
... for visualization Statistics analysis Means and standard error of the mean (SEM) were calculated The one-way analysis of variance (ANOVA) was applied to analyze continuous variables: time latency, ... collected and analyzed data KST interpreted data and wrote the manuscript CRS, JL and HH acquired data FZC analyzed and interpret data YHA designed the study and approved the manuscript Additional material ... pre-clinical and clinical studies showed that allograft could be an alternative nerve graft [2,7,21] Nerve allograft may act as a temporary scaffold across which host axons regenerate Natural or synthetic...
... CanonicalCorrelation Analysis Journal of Statistical Software 2008, 23(12):1-14 Takakura S, Mitsutake N, Nakashima M, Namba H, Saenko VA, Rogounovitch TI, Nakazawa Y, Hayashi T, Ohtsuru A, Yamashita ... reagent and the RNA quality was tested with the Agilent Bioanalyzer 2000 (Agilent Technologies, Santa Clara, CA) The RNA was amplified into antisense RNA (aRNA) as previously described[80] Total ... 26(2):356-363 Takamizawa J, Konishi H, Yanagisawa K, Tomida S, Osada H, Endoh H, Harano T, Yatabe Y, Nagino M, Nimura Y, et al.: Reduced expression of the let-7 microRNAs in human lung cancers in association...
... São Paulo, Brazil) Unconjugated markers were reacted with anti-mouse PE secondary antibody (Guava Technologies, Hayward, CA) Unstained cells were gated on forward scatter to eliminate particulate ... Costa AM, Martins MT, Kobayashi GS, Zucconi E, Fanganiello RD, Salles FT, Almeida AB, Amaral CE, Alonso N, Passos-Bueno MR: New Source of Muscle-Derived StemCells with Potential for Alveolar ... Célia Koiffmann and Cláudia I E de Castro for karyotype analysis and pictures; Marta Cánovas for technical support; Page of 10 (page number not for citation purposes) Journal of Translational...
... Yamamoto Y, Tokuhara M, Takeshita F, Osaki M, Kawamata M, Kato T, Okochi H, Ochiya T: IFATS collection: in vivo therapeutic potential of human adipose tissue mesenchymal stemcells after transplantation ... in animals after acute lung IR Additionally, the number of alveolar sacs was significantly decreased, whereas the crowded score of lung parenchyma was substantially increased in the animals after ... of ADMSC therapy on arterial oxygen saturation (Sat O2 ), carotid arterial blood gas was analyzed prior to left thoracotomy and at 72 h after the IR procedure RVSBP, an indicator of pulmonary arterial...
... CCR5delta32 status appears to have several beneficial effects on the alloHSCT setting: previous analyses revealed that the CCR5-delta32 allele appears to protect against acute graft versus host disease ... 91(12):1628-1634 Bogunia-Kubik K, Jaskula E, Lange A: The presence of functional CCR5 and EBV reactivation after allogeneic haematopoietic stem cell transplantation Bone Marrow Transplant 2007, 40(2):145-150 ... homozygous carriers is in the range of 1% to 3% among caucasians Future approaches to HIV therapy by CCR5-negative alloHSCT may thus be limited by the availability of HLA-matched donors in general and...
... mang hỗn hợp DNA phôi gốc lẫn tếbào iPS toàn thể "Năm trước không thoải mái với từ "vạn năng" , Hans Scholer, chuyên gia tếbàogốc Viện Max Planc nói Tuần v a qua, Yamanaka đ a hệ iPS thứ hai, ... tếbào thể Yamanaka gọi chúng tếbàogốc vạn cảm ứng (iPS cells) "Dễ bỡn Chẳng có phép màu cả." Yamanaka nói Kết mang lại nhiều ngạc nhiên hoài nghi Bốn nhân tố dường Và tếbào có đặc điểm tế ... trứng hay phôi Và ch a làm việc với chúng" Shinya Yamanaka đại học Kyoto, người tiên phong kỹ thuật nói Năm ngoái Yamanaka người sử dụng kỹ thuật người ta dùng tếbào xơ chuột, loại tếbào phổ...