... Tếbàogốcphôi (Embryonic stem cells- ESCs) tếbàomầmphôi (Embryonic germ cells) ∗ Tếbàogốcphôitếbàogốc vạn lấy từ phôi giai đoạn sớm (4-7 ngày tuổi) ∗ Tếbàomầmphôitếbàomầm nguyên ... gốc phân lập ∗ Theo nguồn gốc phân lập xếp loại tếbàogốc làm loại: - Tếbàogốcphôi (trong có tếbàogốcphôi thực thụ tếbàomầm phôi) - Tếbàogốc thai - Tếbàogốc trưởng thành a/ Tếbào ... a/ Tếbàogốcphôi (Embryonic stem cells- ESCs) tếbàomầmphôi (Embryonic germ cells) ∗ Tếbàomầmphôitếbào hình thành nên giao tử phân lập từ phôi 5-9 tuần tuổi từ thai nhi ∗ So với tế bào...
... tếbàogốc tổ chức phôi, bào thai cá thể trởng thành Những tếbàogốc có nguồn gốc khác nh tếbàogốcphôi (bao gồm tếbàogốc từ phôitếbàomầm từ tổ chức bào thai) tếbàogốc cá thể trởng thành ... tếbào máu tuần hoàn mang marker khác với tếbào gan, tuỷ xơng bào thai máu cuống rốn - Tếbàogốcbào thai tếbàomầmbào thai: từ 1985 có nhiều nghiên cứu thu đợc tếbào tiền thân dòng tếbào ... hoá tếbàogốcbào thai tếbàomầmbào thai ngời thành loại tếbào chuyên biệt, sử dụng cho mục đích lâm sàng Tiềm sử dụng tếbàogốcbào thai tranh cãi Mối quan tâm nhiều sử dụng tếbàogốc bào...
... pairs to amplify the truncated form of MsrA and introduce a BamHI cutting site at the 3’ end (MsrA-for: 5’-cctggctgcggaggtggagaaac and MsrA-BamHI-rev: 5’-tggggccaaggatccgctttgaaagaacc) The amplicons ... MsrA cDNA was amplified from the total RNA extracted from cultured embryonicstemcells using the primer pairs of: MsrA-for: 5’-cctggctgcggaggtggagaaac and MsrA-rev: 5’-atggccatcgggcaggaaactcc ... 5’-AGGTATTGCTGGTGGTAGTCTTC; Amplicon size: 395bp MsrA-truncated-for: 5’CGACCCGACCCAAGGTTCTTTCA; MsrA-truncated-rev: 5’-GCCATCGGGCAGGAA ACTCCAG; Amplicon size:168bp b-actin-for: 5’-CCACTGCCGCATCCTCTTCCTC; b-actin-for:...
... MTT absorbance values obtained after exposure, with the initial absorbance reading for the unexposed physiological control maintained at 37oC Raw absorbance values obtained for % survival MTT assay ... serial passages Their appearance was virtually indistinguishable from non-temperature exposed hESC (data not shown) Chromosomal Analysis of hESC after exposure to low temperature Metaphase spreads ... cells were washed off prior to the MTT assay From the raw absorbance values, the survival rate was computed by a simple formula based on reference to the initial absorbance value obtained for the...
... chục tếbàogốc ban đầu tách từ phôi nhân nuôi thành hàng vạn tếbào theo quy trình đặc biệt Kết kiểm tra hình thái tếbào chất thị hoá mô chứng minh tếbào tách từ phôi chuột tếbàogốc Trước ... tiêm tếbàogốc Tách, nhân nuôi khu biệt thành tếbàogốc máu Để tách tếbàogốc từ phôi chuột, ban đầu TS Hùng cộng sử dụng phôi chuột nhắt trắng bình thường (3-4 ngày tuổi) Tiếp đến, vài chục tế ... tránh đào thải nhân phôi tách tếbàogốc Tuy nhiên, chuột mang bệnh di truyền sử dụng trực tiếp tếbào (dù có biến thành tếbàogốc nhân bản) để ch a bệnh Được biết, ba năm qua, TS Bùi Xuân Nguyên...
... essential for de novo methylation and mammalian development Cell 99, 247–257 33 Tsumura A, Hayakawa T, Kumaki Y, Takebayashi S, Sakaue M, Matsuoka C, Shimotohno K, Ishikawa F, Li E, Ueda HR et al ... K, Abe T, Nakano T, Asami T, Ebisuzaki T, Held WA, Yoshida S & Nagase H (2003) Global methylation screening in the Arabidopsis thaliana and Mus musculus genome: applications of virtual image ... N Hattori and K Shiota methylation analysis Although RLGS requires a larger genomic sample than is necessary for microarray-based methods, it has advantages for analyzing genome-wide methylation...
... deoxyribonuclease (DNase I, amplification grade; TaKaRa, Kyoto, Japan) Microarray analysis and data mining (Aligent array) A one-color microarray-based gene expression analysis system (Agilent Technologies, ... 247–256 Sato Y, Araki H, Kato J, Nakamura K, Kawano Y, Kobune M, Sato T, Miyanishi K, Takayama T, Takahashi M et al (2005) Human mesenchymal stemcells xenografted directly to rat liver are differentiated ... regulated by differential roles of Cdc42 and Rac1 Dev Cell 7, 425–438 33 Hatada I, Fukasawa M, Kimura M, Morita S, Yamada K, Yoshikawa T, Yamanaka S, Endo C, Sakurada A, Sato M et al (2006) Genome-wide...
... for visualization Statistics analysis Means and standard error of the mean (SEM) were calculated The one-way analysis of variance (ANOVA) was applied to analyze continuous variables: time latency, ... collected and analyzed data KST interpreted data and wrote the manuscript CRS, JL and HH acquired data FZC analyzed and interpret data YHA designed the study and approved the manuscript Additional material ... pre-clinical and clinical studies showed that allograft could be an alternative nerve graft [2,7,21] Nerve allograft may act as a temporary scaffold across which host axons regenerate Natural or synthetic...
... CanonicalCorrelation Analysis Journal of Statistical Software 2008, 23(12):1-14 Takakura S, Mitsutake N, Nakashima M, Namba H, Saenko VA, Rogounovitch TI, Nakazawa Y, Hayashi T, Ohtsuru A, Yamashita ... LG, Luttun A, Crabbe A, Geraerts M, Sharov AA, Piao Y, Ko MS, et al.: Comparative transcriptome analysis of embryonic and adult stemcells with extended and limited differentiation capacity Genome ... reagent and the RNA quality was tested with the Agilent Bioanalyzer 2000 (Agilent Technologies, Santa Clara, CA) The RNA was amplified into antisense RNA (aRNA) as previously described[80] Total...
... São Paulo, Brazil) Unconjugated markers were reacted with anti-mouse PE secondary antibody (Guava Technologies, Hayward, CA) Unstained cells were gated on forward scatter to eliminate particulate ... Costa AM, Martins MT, Kobayashi GS, Zucconi E, Fanganiello RD, Salles FT, Almeida AB, Amaral CE, Alonso N, Passos-Bueno MR: New Source of Muscle-Derived StemCells with Potential for Alveolar ... SH3 and SH4) The isolated cells from hFTs were also positive for HLA-class I (HLA-ABC) but negative for HLA-class II (HLA-DR), and negative as well for the embryonicstem cell factor SSEA4 and...
... Yamamoto Y, Tokuhara M, Takeshita F, Osaki M, Kawamata M, Kato T, Okochi H, Ochiya T: IFATS collection: in vivo therapeutic potential of human adipose tissue mesenchymal stemcells after transplantation ... in animals after acute lung IR Additionally, the number of alveolar sacs was significantly decreased, whereas the crowded score of lung parenchyma was substantially increased in the animals after ... of ADMSC therapy on arterial oxygen saturation (Sat O2 ), carotid arterial blood gas was analyzed prior to left thoracotomy and at 72 h after the IR procedure RVSBP, an indicator of pulmonary arterial...
... CCR5delta32 status appears to have several beneficial effects on the alloHSCT setting: previous analyses revealed that the CCR5-delta32 allele appears to protect against acute graft versus host disease ... 91(12):1628-1634 Bogunia-Kubik K, Jaskula E, Lange A: The presence of functional CCR5 and EBV reactivation after allogeneic haematopoietic stem cell transplantation Bone Marrow Transplant 2007, 40(2):145-150 ... homozygous carriers is in the range of 1% to 3% among caucasians Future approaches to HIV therapy by CCR5-negative alloHSCT may thus be limited by the availability of HLA-matched donors in general and...
... mang hỗn hợp DNA phôigốc lẫn tếbào iPS toàn thể "Năm trước không thoải mái với từ "vạn năng", Hans Scholer, chuyên gia tếbàogốc Viện Max Planc nói Tuần v a qua, Yamanaka đ a hệ iPS thứ hai, ... tếbào thể Yamanaka gọi chúng tếbàogốc vạn cảm ứng (iPS cells) "Dễ bỡn Chẳng có phép màu cả." Yamanaka nói Kết mang lại nhiều ngạc nhiên hoài nghi Bốn nhân tố dường Vàtếbào có đặc điểm tế ... trứng hay phôiVà ch a làm việc với chúng" Shinya Yamanaka đại học Kyoto, người tiên phong kỹ thuật nói Năm ngoái Yamanaka người sử dụng kỹ thuật người ta dùng tếbào xơ chuột, loại tếbào phổ...