0

13predicting the functional significance for the co expression of lineage defining transcription factors in t helper cells

Tài liệu Báo cáo khoa học: Roles of AP-2 transcription factors in the regulation of cartilage and skeletal development doc

Tài liệu Báo cáo khoa học: Roles of AP-2 transcription factors in the regulation of cartilage and skeletal development doc

Báo cáo khoa học

... failure in post-transcriptional processing of the protein [41] Additionally, it is evident that AP-2 transcription factors can indirectly modulate genes by functional interactions with other transcription ... an increase in apoptosis [73] The authors of this study ascribe the regulation of outgrowth of limb buds and patterning of the digits to the chicken AP-2 The role of AP-2a was further studied in ... regulates many genes that determine the osteoblast phenotype, as the forced expression of Runx2 in nonosteoblast cells is sufficient to induce the osteoblast-specific gene osteocalcin [60] The inactivation...
  • 9
  • 642
  • 0
Báo cáo khoa học: The yeast stress response Role of the Yap family of b-ZIP transcription factors The PABMB Lecture delivered on 30 June 2004 at the 29th FEBS Congress in Warsaw potx

Báo cáo khoa học: The yeast stress response Role of the Yap family of b-ZIP transcription factors The PABMB Lecture delivered on 30 June 2004 at the 29th FEBS Congress in Warsaw potx

Báo cáo khoa học

... conditions shuttles to and from the nucleus [31] This is in contrast to the results obtained by Wysocki et al [10] and may be due to the fact that the latter use a multicopy vector, whereas the ... almost 33% identity 2643 Yap proteins and the yeast response to stress C Rodrigues-Pousada et al computational interactome data that predict their interaction [63] Interestingly, the observation that ... preventing the formation of the competing Orp1 Cys36-Cys82 disulfide bond Once activated, the Yap1 NES that lies within the c-CRD is masked leading to its retention in the nucleus and the up-regulation...
  • 9
  • 346
  • 0
Báo cáo y học:

Báo cáo y học: "Oxygen-sensing mechanisms and the regulation of redox-responsive transcription factors in development and pathophysiology" ppsx

Báo cáo khoa học

... via the reported Flt-1 HRE [100] Interestingly, HIF-1 activity could be restored fully by point-mutating the ET-1 (but not the Flt-1) HBS, suggesting that the wild-type ET-1 HBS attenuates the ... leads to increasing intracellular stores of GSSG, a potent inhibitor of NF-κB transcription factor DNA binding The pathway leading to the formation of GSH by the action of γ-glutamylcysteine synthetase ... not for citation purposes) Available online http://respiratory-research.com/content/3/1/26 a decrease in the thickness of the interstitium, thinning of the epithelium and separation of the terminal...
  • 27
  • 342
  • 0
Analysis of transcription factors in living human cells with the help of split ubiquitin system

Analysis of transcription factors in living human cells with the help of split ubiquitin system

Tổng hợp

... protein (TBP) In some genes, the transcription initiation site consists of the initiator element (Inr) defined as an element encompassing the transcription start site that binds regulatory factors ... Protein-protein interactions are crucial for the formation of complexes involved in the regulation of transcription Interactions of the human linker histone hH1 with the other core histone proteins, ... activating sequences Activators consist of two domains: one is the DNA binding domain and the other is activating domain which stimulates the activity of transcriptional apparatus Transcriptional...
  • 124
  • 346
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Constitutive expression of Atlantic salmon Mx1 protein in CHSE-214 cells confers resistance to Infectious Salmon Anaemia virus" ppt

Điện - Điện tử

... encodes protein(s) with IFN antagonistic properties, giving the virus an advantage in its fight against the antiviral host response to infection The complete ISAV protein profile has not yet ... reported to localize in the cytoplasm [15] Thus in this context, the ASMx1 activity on ISAV may resemble that of the human MxA protein on influenza A virus To our knowledge these are the first studies ... effect (CPE), Tris borate EDTA (TBE) Competing interests The author(s) declare that they have no competing interests Page of (page number not for citation purposes) Virology Journal 2005, 2:75 http://www.virologyj.com/content/2/1/75...
  • 6
  • 318
  • 0
báo cáo hóa học:

báo cáo hóa học:" Constitutive expression of Atlantic salmon Mx1 protein in CHSE-214 cells confers resistance to Infectious Salmon Anaemia virus" docx

Hóa học - Dầu khí

... encodes protein(s) with IFN antagonistic properties, giving the virus an advantage in its fight against the antiviral host response to infection The complete ISAV protein profile has not yet ... reported to localize in the cytoplasm [15] Thus in this context, the ASMx1 activity on ISAV may resemble that of the human MxA protein on influenza A virus To our knowledge these are the first studies ... effect (CPE), Tris borate EDTA (TBE) Competing interests The author(s) declare that they have no competing interests Page of (page number not for citation purposes) Virology Journal 2005, 2:75 http://www.virologyj.com/content/2/1/75...
  • 6
  • 260
  • 0
Báo cáo y học:

Báo cáo y học: " Induction of the HIV-1 Tat co-factor cyclin T1 during monocyte differentiation is required for the regulated expression of a large portion of cellular mRNAs" pptx

Báo cáo khoa học

... ACCGTTTGTTGTTGTTCTTCCTCTC, Cdk9 (forward) AGCACCAACTCGCCCTCATC, Cdk9 (reverse) TTCAGCCTGTCCTTCACCTTCC Competing interests The author(s) declare that they have no competing interests Authors' contributions ... cycle prior to transcription of the integrated provirus, MM6 cells were first infected with either the Tat+ or Tat-reporter virus Three days later, the cultures were infected with the lentiviral ... shRNACycT1: GCAGCGTCTTAACGTCTCA; shRNA-Control: GCTATAGCTGTTCTAGTTC Oligo-nucleotides containing the target sequences with overhangs compatible with restriction enzyme sites were purchased from Invitrogen...
  • 16
  • 178
  • 0
Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

Báo cáo khoa học

... phase conservation of the intron– exon boundaries that lie either side of the exon encoding the extracellular domain This lends support to the theory that the ligand specificity of these receptors ... [8,9] In the absence of cripto, the type I activin receptor can mediate signal transduction stimulated by activin but not nodal Mutations in the gene encoding the mouse type IB activin receptor, ... distributed diffusely in the cytoplasm, become localized in all four of the macromere cells at the eight-cell stage These transcripts then segregate into the second and third quartet of micromeres...
  • 17
  • 508
  • 0
Báo cáo y học:

Báo cáo y học: "tatin-induced expression of CD59 on vascular endothelium in hypoxia: a potential mechanism for the anti-inflammatory actions of statins in rheumatoid arthritis" pptx

Báo cáo khoa học

... atorvastatin and simvastatin upregulate the expression of the complement-inhibitory protein (CIP) DAF on EC, and that this, by acting at the level of the C3 convertase, inhibits complement activation ... hypoxic conditions may contribute to an anti-inflammatory action of statins in RA The combined effects of DAF, at the level of C3 and C5 convertases, and of CD59 inhibiting the terminal attack complex ... the inhibition of HMG-CoA reductase, therefore preventing the post-translational modification of the GTP-binding proteins Rho, Rac and Ras This results in anti-inflammatory effects including the...
  • 12
  • 510
  • 0
Báo cáo y học:

Báo cáo y học: " The functional expression of extracellular calcium-sensing receptor in rat pulmonary artery smooth muscle cells" potx

Báo cáo khoa học

... ttcggcatcagctttgtgctctgtatctcgtgcatcttggtgaagaccaatcgcgtcctcctggtatttgaagccaagatacccaccagcttc caccggaagtggtgggggctcaacct gcagttcctgctggttttcctctgcaccttcatgcagatcctcatctgcatcatctggctctacacggcgcccccctc tagcaccgcaaccatgagctggaagacgaaatcatcttca The sequence ... fragments could be detected, indicating the tested RNA samples were free of genomic DNA contamination Sequencing results were as follows: ttcggcatcagctttgtgctctgtatctcgtgcatcttggtgaagaccaatcgcgtcctcctggtatttgaagccaagatacccaccagcttc ... 5’-ttcggcatcagctttgtg-3’, antisense 5’-tgaagatgatttcgtcttcc3’; (2) GAPDH: sense 5’-ctcaactacatggtctacatg -3’, antisense 5’-tggcatggactgtggtcatgag-3’, yielding predicted products of 234 and 420 bp, respectively...
  • 8
  • 350
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Skipping the co-expression problem: the new 2A "CHYSEL" technology" ppt

Báo cáo khoa học

... its translation, interacts with the exit tunnel of the ribosome to induce the "skipping" of the last peptide bond at the C-terminus of 2A The crucial point is that the ribosome is able to continue ... in the gene therapy field They provide a good example of the potential of the 2A coexpression strategy, introducing up to four genes in a single vector Furthermore, they show the utility of this ... the efficient formation of the TCR:CD3 complex and just two retroviral vectors were sufficient to reconstruct it in transfected 29 3T or infected 3T3 cells: one encoding both subunits of the T- cell...
  • 6
  • 185
  • 0
Tài liệu Báo cáo khoa học: Bioimaging of the unbalanced expression of microRNA9 and microRNA9* during the neuronal differentiation of P19 cells doc

Tài liệu Báo cáo khoa học: Bioimaging of the unbalanced expression of microRNA9 and microRNA9* during the neuronal differentiation of P19 cells doc

Báo cáo khoa học

... GAT CTAGA TCT TTG GTT ATC TAG CTG TAT GA TACTA TCT TTG GTT ATC TAG CTG TAT GA TACTA TCT TTG GTT ATC TAG CTG TAT GA ACTAGATTC TCGAGAATC TAG TAC TTT CGG TTA TCT AGC TTT A TAGTA ACT TTC GGT TAT CTA ... GCT TTA TAGTA ACT TTC GGT TAT CTA GCT TTAT CTA GAT AAA GCT AGA TAA TTG AAA GT TACTA TAA AGC TAG ATA ACC GAA AGT TACTA TAA ACG TAC ATA ACC GAA AGT ACTAGATTC Amplify 1343mer promoter fragment Amplify ... Perfect target seq of miR9 sense GCA CAA GCT TGG AGT GTG AAA GGA TGA GCA CAA GCT TCT TTC CTC CCC TCC GCC CCT CTC AT GCA CAA GCT TCA CCG CGG CTC CCC ATT TCC ATC GCA CAA GCT TGG TCA TCG CGT CCT TTC...
  • 12
  • 612
  • 0
Tài liệu Báo cáo khoa học: Down-regulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines docx

Tài liệu Báo cáo khoa học: Down-regulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines docx

Báo cáo khoa học

... lane contains 15 lg total RNA The bottom panel shows the expression of 18S rRNA as an internal control Note that the blot was exposed to the film for the longest time (1 min) to detect the low expression ... protein was normalized with respect to the intensity of the b-actin signal The ratio of each normalized value to the control value in siRNA-untreated cells (control) is shown as the relative expression ... levels, the same filter was reused for b-actin monoclonal antibody The intensity representing HO-1 or HO-2 protein was normalized with respect to the intensity for the b-actin signal The data are...
  • 14
  • 487
  • 0
Tài liệu Báo cáo khoa học: Characterization of the promoter for the mouse a3 integrin gene Involvement of the Ets-family of transcription factors in the promoter activity doc

Tài liệu Báo cáo khoa học: Characterization of the promoter for the mouse a3 integrin gene Involvement of the Ets-family of transcription factors in the promoter activity doc

Báo cáo khoa học

... greatly decreased the promoter activity, whereas mutations in the other Ets-binding site at )248 (TTCC to TTAC), the E-box at )241 (CAGGTG to TCGGTG), or the GATAbinding site at )212 (GATA to CTAA) ... addition, the specific binding of a nuclear protein to the oligonucleotide containing the Ets consensus sequence was detected in EMSA These results suggest that the transcription of the mouse integrin ... several transcription factors including Ets, GATA, and MyoD/E-box binding factors The introduction of mutation into one of the putative Etsbinding sequences suppressed the promoter activity In addition,...
  • 9
  • 562
  • 0
Báo cáo khoa học: A simple in vivo assay for measuring the efficiency of gene length-dependent processes in yeast mRNA biogenesis doc

Báo cáo khoa học: A simple in vivo assay for measuring the efficiency of gene length-dependent processes in yeast mRNA biogenesis doc

Báo cáo khoa học

... transcript of the expected length was detected (Fig 1B) The intensity of the mRNA signals corresponding to the wild-type cells inversely correlated to the length of the transcription units (see ... sensitive to mutations affecting the Tho2-Hpr1-Mft1Thp1 (THO) complex [14], connected to transcription elongation and mRNP formation [15] Taking the dependence on the length of the transcription ... hypothesized that gene length is the key element that distinguishes between factors involved in the initial steps of transcription and factors in uencing mRNA biogenesis all along the transcription...
  • 14
  • 435
  • 0
Báo cáo khoa học: Myocyte enhancer factor 2B is involved in the inducible expression of NOX1⁄ NADPH oxidase, a vascular superoxide-producing enzyme ppt

Báo cáo khoa học: Myocyte enhancer factor 2B is involved in the inducible expression of NOX1⁄ NADPH oxidase, a vascular superoxide-producing enzyme ppt

Báo cáo khoa học

... ⁄ activating transcription factor (ATF) family, ATF-1, was suggested to take part in the induction of NOX1 expression [8–10] Except for the involvement of ATF-1, the entire picture of the transcriptional ... MEF2-binding site and the AP-1 site, and a TATA-like sequence located upstream of the transcription initiation site (B) Introduction of mutations at the MEF2-binding site (5¢-CTATAAATAG-3¢ to 5¢-CTATAgccAG-3¢) ... the mouse c-type mRNA, however, the rat c-type-like NOX1 mRNA neither contained the counterpart of the mouse exon 1b nor encoded an additional N-terminal peptide Although the counterpart of the...
  • 9
  • 452
  • 0
báo cáo hóa học:

báo cáo hóa học:" The paradoxical patterns of expression of indoleamine 2,3-dioxygenase in colon cancer" docx

Hóa học - Dầu khí

... epithelium, the expression of IDO and Bin1 was interpreted for immunoreactivity using the 0–4 semi-quantitative system of Gastl [37] for both the intensity of staining and the percentage of positive ... implying that the IDO in TDLN contributes to tumor progression, regardless of the immunogenicity of the primary tumors Furthermore, this study also indicated that the IDO +cells in TDLN were not induced ... 12 Conclusion This study observed the paradoxical patterns of IDO expression in colon cancer One was the fact that a higher density of IDO +cells existed in TDLN, the other was the fact that the...
  • 8
  • 568
  • 0
báo cáo hóa học:

báo cáo hóa học: " The effect of consequent exposure of stress and dermal application of low doses of chlorpyrifos on the expression of glial fibrillary acidic protein in the hippocampus of adult mice" pptx

Hóa học - Dầu khí

... designed the study KL and AT conducted the study NKM conducted statistical analysis of the collected data All authors have contributed, read and approved the final manuscript Competing interests The ... that alterations in the cholinergic neurotransmitter systems due to stress are the initial events contributing to CNS impairment and that exacerbation of injury could occur with the concurrent ... (B0) To obtain standard curve, concentration standards were plotted against logit values Logit of the data was then employed in Microsoft Excel to get the serum concentrations of corticosterone...
  • 9
  • 451
  • 0
báo cáo hóa học:

báo cáo hóa học:" Expression of Bone Morphogenetic Protein-2 in the Chondrogenic and Ossifying Sites of Calcific Tendinopathy and Traumatic Tendon Injury Rat Models" doc

Hóa học - Dầu khí

... made to expose the patellar tendon The central one-third of the patellar tendon (1 × mm) from the distal apex of the patellar to the insertion of the tibial tuberosity was then removed and the ... pathway might be activated in both traumatic and collagenase-induced tendon injuries The extent of injury might determine the healed or fail-healing status, consistent with failed healing in tendinopathy ... expression of BMP-2 and the role of BMP-2 signaling pathway in tendon cell differentiation and tendon degeneration Competing interests The authors declare that they have no competing interests...
  • 6
  • 291
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " The effects of hypertonic fluid administration on the gene expression of inflammatory mediators in circulating leucocytes in patients with septic shock: a preliminary study" pptx

Hóa học - Dầu khí

... referral teaching hospital Informed consent was obtained from patients or their nearest relative This study is part of a trial that investigated the cardiovascular effects and the effects on gastric ... to make cDNA and then the ratio of the Housekeeper gene to the gene of interest was used Because the housekeeper gene is not affected by the treatment, the Ct and the efficiency of amplification ... “time×treatment-group” interaction term was the indication of the evolution of different responses between the two treatment groups We used the Tukey-Kramer Multiple-Comparison test for posthoc comparisons...
  • 8
  • 515
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25