DẠY HÓA BẰNG TIẾNG ANH HÓA HỮU CƠ (p4)

22 482 1
DẠY HÓA BẰNG TIẾNG ANH  HÓA HỮU CƠ (p4)

Đang tải... (xem toàn văn)

Tài liệu hạn chế xem trước, để xem đầy đủ mời bạn chọn Tải xuống

Thông tin tài liệu

CHAPTER 15 ORGANIC COMPOUNDS AND THE ATOMIC PROPERTIES OF CARBON CHAPTER REVIEW GUIDE The following sections provide many aids to help you study this chapter (Numbers in parentheses refer to pages, unless noted otherwise) Learning Objectives These are concepts and skills you should know after studying this chapter Relevant section (§), sample problem (SP), and upcoming end of chapter problem (EP) numbers appear in parentheses Explain why carbon’s atomic properties lead to formation of four strong bonds, multiple bonds, chains, and functional groups (§15.1) (EPs 15.1-15.4) Name and draw alkanes, alkenes, and alkynes with expanded, condensed, and carbon3 skeleton formulas (§15.2) (SPs 15.1, 15.2a-c) (EPs 15.5, 15.9-15.18, 15.29) Distinguish among constitutional, optical, and geometric isomers (§15.2) (SP 15.2d, e) (EPs 15.6-15.8, 15.19- 15.28, 15.30, 15.31) Describe three types of organic reactions (addition, elimination, and substitution) and identify each type from reactants and products (§15.3) (SP 15.3) (EPs 15.32- 15.36) Understand the properties and reaction types of the various functional groups (§15.4) (SPs 15.4-15.6) (EPs 15.37— 15.58) Discuss the formation of addition and condensation polymers and draw abbreviated polymer formulas (§15.5) (EPs 15.59-15.67) Describe the three types of natural polymers, explain how amino-acid sequence determines protein shape, and thus function, draw small peptides, and use the sequence of one DNA strand to predict the sequence of the other (§15.6) (EPs 15.6815.79) HƯỚNG DẪN ÔN TẬP CHƯƠNG Những phần bên đưa lời giải nhằm giúp bạn học tốt chương (số ngoặc đơn số trang, trừ ghi khác.) Mục tiêu học tập Dưới kĩ khái niệm để ôn tập sau học chương Phần liên quan (), tập ví dụ (SP), ví dụ kết thúc chương (EP) số đặt ngoặc Giải thích tính chất nguyên tử cacbon lại dẫn đến việc hình thành bốn liên kết bền, liên kết bội, chuỗi nhóm chức (15.1) (Eps 15.1-15.4) Danh pháp cách vẽ ankan, anken, ankin với công thức khai triển, thu gọn, thu gọn (15.2) (SPs 15.1, 15.2a-c) (EPs 15.5, 15.9-15.18, 15.29) Phân biệt đồng phân lập thể, đồng phân quang học đồng phân hình học (15.2) (SP 15.2d, e) (Eps 15.6-15.8, 15.19-15.28, 15.30, 15.31) Mô tả ba loại phản ứng hóa học hữu (phản ứng cộng, phản ứng tách phản ứng thế) xác định loại từ chất tham gia chất sản phẩm (15.3) (SP 15.3) (Eps 15.3215.36) Hiễu rõ tính chất loại phản ứng nhóm chức khác (15.4) (SPs 15.4-15.6) (Eps 15.37-15.58) Thảo luận hình thành polime phản ứng trùng cộng phản ứng trùng ngưng, viết công thức viết tắ polime (15.5) (Eps 15.59-15.67) Mô tả ba loại polime tự nhiên, giải thích chuỗi axit amin định đến hình dạng protein, suy chức năng, viết chuỗi peptit nhỏ, sử dụng chuỗi sợi DNA để suy đoán chuỗi khác (15.6) (Eps 15.68-15.79) Key Terms These important terms appear in boldface in the chapter and are defined again in the Glossary Introduction alkene (CnH2n) (640) organic compound (629) unsaturated hydrocarbon (640) Section 15.1 geometric (cis-trans) isomers (641) heteroatom (631) alkyne (CnH2n—2) (643) functional group (631) aromatic hydrocarbon (644) Section 15.2 Section 15.3 hydrocarbon (632) alkyl group (646) alkane (CnH2n+2) (635) addition reaction (647) homologous series (635) elimination reaction (648) saturated hydrocarbon (635) substitution reaction (648) cyclic hydrocarbon (637) Section 15.4 isomers (637) alcohol (650) constitutional (structural) isomers (637) haloalkane (alkyl halide) (652) stereoisomers (639) amine (652) optical isomers (639) carbonyl group (655) chiral molecule (639) aldehyde (655) polarimeter (640) ketone (655) optically active (640) organometallic compound (656) carboxylic acid (657) Section 15.6 ester (657) monosaccharide (666) amide (657) polysaccharide (666) fatty acid (658) disaccharide (666) acid anhydride (658) protein (667) lipid (658) amino acid (667) hydrolysis (659) nucleic acid (670) nitrile (661) mononucleotide (670) Section 15.5 double helix (671) addition polymer (663) base pair (671) condensation polymer (664) genetic code (671) Những thuật Các thuật ngữ quan trọng xuất phần in đậm bên định nghĩa lại phần Thuật ngữ Giới thiệu hợp chất hữu (460) Phần 15.1 liên kết thành chuỗi (460) nguyên tử khác loại (461) nhóm chức (461) Phần 15.2 hydrocacbon (462) ankan (CnH2n+2) (464) dãy đồng đẳng (464) hydrocacbon no (464) cyclic hydrocacbon (466) đồng phân (467) đồng phân cấu trúc (467) đồng phân lập thể (468) đồng phân quang học (468) phân tử bất đối xứng (468) hoạt tính quang học (469) anken (CnH2n) (469) hydrocacbon không no (469) đồng phân hình học (cis-trans) ankin (CnH2n-2) (470) hydrocacbon thơm (471) Phần 15.3 nhóm ankin (472) phản ứng cộng (473) phản ứng tách (473) phản ứng (473) Phần 15.4 alcohol (476) haloankan (476) amin (477) nhóm cacbonyl (479) anđêhit (479) xeton (479) axit cacboxylic (480) este (480) amit (480) axit béo (480) andydrit axit (480) lipid (481) phản ứng thủy phân (481) nitrile (482) Phần 15.5 polime (483) đại phân tử (483) tiểm phân tử (483) polime phản ứng trùng cộng (483) polime phản ứng trùng ngưng (484) Phần 15.6 monosaccharit (486) polysaccharit (486) disaccharit (486) protein (487) axit amin (487) axit nucleic (490) mononucleotit (490) chuỗi xoắn kép (491) cặp bazơ (491) mã di truyền (491) PROBLEMS Problems with colored numbers are answered in Appendix E Sections match the text and provide the numbers of relevant sample problems Bracketed problems are grouped in pairs (indicated by a short rule) that cover the same concept Comprehensive Problems are based on material from any section or previous chapter The Special Nature of Carbon and the Characteristics of Organic Molecules 15.1 Explain each statement in terms of atomic properties: (a) Carbon engages in covalent rather than ionic bonding (b) Carbon has four bonds in all its organic compounds (c) Carbon forms neither stable cations, like many metals, nor stable anions, like many nonmetals (d) Carbon bonds to itself more extensively than does any other element (e) Carbon forms stable multiple bonds 15.2 Carbon bonds to many elements other than itself (a) Name six elements that commonly bond to carbon in organic compounds (b) Which of these elements are heteroatoms? (c) Which of these elements are more electronegative than carbon? Less electronegative? (d) How does bonding of carbon to heteroatoms increase the number of organic compounds? 15.3 Silicon lies just below carbon in Group 4A(14) and also forms four covalent bonds Why aren’t there as many silicon compounds as carbon compounds? 15.4 Which of these bonds to carbon would you expect to be relatively reactive: C—H, C—C, C—I, C=O, C—Li? Explain Bài tập Các tập in đậm giải Phụ lục E Phần phù hợp với đề cung cấp số tập liên quan Các tập ngoặc nhóm theo cặp (được xác định theo quy luật) chung khái niệm Nói dễ hiểu tập dựa vào tài liệu từ phần chương trước Tính tự nhiên đặc trưng cacbon đặc điểm phân tử hữu 15.1 Giải thích tính chất nguyên tử câu bên (a) Cacbon xu hướng tham gia vào liên kết cộng hóa trị liên kết ion (b) Cacbon bốn liên kết tất hợp chất hữu (c) Cacbon hình thành ion dương giống kim loại, ion âm giống phi kim (d) Cacbon liên kết với cách giãn rộng so với nguyên tử khác (e) Cacbon hình thành liên kết bội bền 15.2 Cacbon liên kết với nguyên tố khác nhiều tự liên kết với (a) Kể tên sáu nguyên tố thường liên kết với cacbon hợp chất hữu (b) Nguyên tố nguyên tử khác loại? (c) Nguyên tố độ âm điện lớn cacbon? nguyên tố hơn? (d) Tại liên kết cacbon với nguyên tử khác loại làm tăng số lượng hợp chất hữu cơ? 15.3 Silicon nằm bên cacbon Nhóm 4A(14) hình thành bốn liên kết cộng hóa trị Tại hợp chất silicon lại nhiều hợp chất cacbon? 15.4 Cặp liên kết với cacbon xảy phản ứng: C-H, C-C, C-I, C=O, CLi? Giải thích The Structures and Classes of Hydrocarbons (Sample Problems 15.1 and 15.2) 15.5 (a) What structural feature is associated with each type of hydrocarbon: alkane, cycloalkane, alkene, and alkyne? (b) Give the general formula for each type (c) Which hydrocarbons are considered saturated? 15.6 Define each type of isomer: (a) constitutional; (b) geometric; (c) optical Which types of isomers are stereoisomers? 15.7 Among alkenes, alkynes, and aromatic hydrocarbons, only alkenes exhibit cis-trans isomerism Why don’t the others? 15.8 Which objects are asymmetric (have no plane of symmetry): (a) circular clock face; (b) a football; (c) a dime; (d) a brick; (e) a hammer; (f) a spring? 15.9 Draw all possible skeletons for a 7-C compound with (a) A 6-C chain and double bond (b) A 5-C chain and double bond (c) A 5-C ring and no double bonds 15.10 Draw all possible skeletons for a 6-C compound with (a) A 5-C chain and double bonds (b) A 5-C chain and triple bond (c) A 4-C ring and no double bonds 15.11 Add the correct number of hydrogens to each of the skeletons in Problem 15.9 15.12 Add the correct number of hydrogens to each of the skeletons in Problem 15.10 15.13 Draw correct structures, by making a single change, for any that are incorrect: CH3 (a) CH3 CH CH2 CH3 (b) CH3 CH CH2 CH3 (d) H3C CH2 CH3 CH3 (c) CH C CH3 CH2 CH3 15.14 Draw correct structures, by making a single change, for any that are incorrect: 15.15 Draw the structure or give the name of each compound: (a) 2,3-dimethyloctane (b) l-ethyl-3-methylcyclohexane CH3 CH3 CH2 CH (c) CH CH3 CH2 (d) CH2 CH3 15.16 Draw the structure or give the name of each compound: H3C (a) CH3 (b) CH3 (c) 1,2-diethylcyclopentane (d) 2,4,5-trimethylnonane Each of the following names is wrong Draw structures based on them, and correct the names: (a) 4-methylhexane (b) 2-ethylpentane 15.17 (c) 2-methylcyclohexane (d) 3,3-methyl-4-ethyloctane Each of the following names is wrong Draw structures based on them, and correct the names: (a) 3,3-dimethylbutane (b) 1,1,1-trimethylheptane 15.18 (c) 1,4-diethylcyclopentane (d) 1-propylcyclohexane 15.19 Each of the following compounds can exhibit optical activity Circle the chiral center(s) in each: H H H (a) Cl H C C H H C C H H H (b) H H H H C C C H H H C H C H H C C H H H H 15.20 Each of the following compounds can exhibit optical activity Circle the chiral center(s) in each: H H H C C (a) C C H OH H C C H H H C H H C H (b) H H H 15.21 Draw structures from the following names, and determine which compounds are optically active: (a) 3-bromohexane (b) 3-chloro-3-methylpentane (c) l,2-dibromo-2-methylbutane 15.22 Draw structures from the following names, and determine which compounds are optically active: (a) 1,3-dichloropentane (b) 3-chloro-2,2,5-trimethylhexane (c) -bromo-1 -chlorobutane 15.23 Which of the following structures exhibit geometric isomerism? Draw and name the two isomers in each case: (a) CH3 CH2 CH3 CH CH CH3 (b) (c) CH C H 3C CH CH CH2 H3C 15.24 Which of the following structures exhibit geometric isomerism? Draw and name the two isomers in each case: CH3 (a) CH3 C CH CH CH3 (b) CH3 Cl (c) Cl CH2 CH C CH2 CH2 CH2 CH3 15.25 Which compounds exhibit geometric isomerism? Draw and name the two isomers in each case: (a) propene (b) 3-hexene (c) 1,1-dichloroethene (d) 1,2-dichloroethene 15.26 Which compounds exhibit geometric isomerism? Draw and name the two isomers in each case: (a) 1-pentene (b) 2-pentene (c) 1-chloropropene (d) 2-chloropropene 15.27 Draw and name all the constitutional isomers of diclorobenzene 15.28 Draw and name all the constitutional isomers of trimethylbenzene 15.29 Butylated hydroxytoluene (BHT) is a common preservative added to cereals and other dry foods Its systematic name is 1-hydroxy-2,6-di-tert-butyl-4methylbenzene (where “tert-butyl” is 1,1-dimethylethyl) Draw the stracture of BHT 15.30 There are two compounds with the name 2-methyl-3- hexene, but only one with the name 2-methyl-2-hexene Explain with structures 15.31 Any tetrahedral atom with four different groups attached can be a chiral center Which of these species is optically active? (a) CHClBrF (b) NBIC12H+ (c) PFClBrI+ (d) SeFCIBrH Cấu trúc phân loại hydrocacbon (Bài tập 15.1 15.2) 15.5 (a) Đặc điểm cấu trúc liên quan đến loại hydrocacbon: ankan, cycloankan, anken, ankin? (b) Nêu công thức chung loại (c) Hydrocacbon xem no? 15.6 Định nghĩa loại đồng phân: (a) đồng phân cấu trúc, (b) đông phân hình học, (c) đồng phân quang học Loại số đồng phân đồng phân lập thể? 15.7 Giữa anken, ankin, hydrocacbon thơm, anken đồng phân cis-trans Tại loại khác không? 15.8 Những vật sau không đối xứng: (a) đồng hồ mặt tròn; (b) bóng; (c) đồng xu; (d) viên gạch; (e) búa, (f) lò xo? 15.9 Viết tất công thức cấu tạo thu gọn hợp chất 7-C với (a) Chuỗi 6-C liên kết đôi (b) Chuỗi 5-C liên kết đôi (c) Vòng 5-C liên kết đôi 15.10 Viết tất công thức cấu tạo thu gọn hợp chất 6-C với (a) Chuỗi 5-C liên kết đôi (b) Chuỗi 5-C liên kết ba (c) Vòng 4-C liên kết đôi 15.11 Cân số hóa trị hydrogen công thức cấu tạo thu gọn Bài tập 15.9 15.12 Cân số hóa trị hydrogen công thức cấu tạo Bài tập 15.10 15.13 Viết cấu tạo cách thay đổi liên kết đơn mà thấy phù hợp 15.14 Viết cấu tạo cách thay đổi liên kết đơn mà thấy phù hợp 15.15 Viết cấu tạo nêu tên hợp chất: 15.16 Viết cấu tạo nêu tên hợp chất: 15.17 Mỗi tên bên bị sai Hãy vẽ cấu tạo chúng sửa lại tên: 15.19 Mỗi hợp chất hoạt tính hình học Khoanh tròn (các) trung tâm đối xứng câu: 15.20 Mỗi hợp chất bên hoạt tính quang học Khoanh tròn (các) trung tâm đối xứng câu: (a) (b) 15.21 Viết cấu tạo danh pháp đây, xác định hợp chất hoạt tính quang học: (a) 3-bromohexan (b) 3-chloro-3-metylpentan (c) 1,2-dibromo-2-metylbutan 15.22 Viết cấu tạo danh pháp đây, xác định hợp chất hoạt tính quang học: 15.23 Cấu tạo đồng phân hình học? Viết công thức cấu tạo kể tên hai đồng phân câu: 15.24 Cấu tạo đồng phân hình học? Viết công thức cấu tạo kể tên hai đồng phân câu: 15.25 Hợp chất đồng phân hình học? Viết công thức cấu tạo kể tên hai đồng phân câu: 15.26 Hợp chất đồng phân hình học? Viết công thức cấu tạo kể tên hai đồng phân câu: 15.27 Viết kể tên toàn đồng phân cấu trúc dichlorobenzen 15.28 Viết kể tên toàn đồng phân cấu trúc trimetylbenzen 15.29 Butylated Hydroxy Toluene (BHT) chất bảo quản thường cho vào loại ngũ cốc Tên hệ thống 1-hydroxy-2,6-di-tert-butyl-4-metylbenzen ( từ “tert-butyl” 1,1-dimetyletyl) Viết cấu tạo BHT 15.30 hai hợp chất tên 2-metyl-3-hexen, hợp chất tên 2metyl-2-hexen Giải thích cấu trúc 15.31 Bất kì nguyên tử tứ diện bốn nhóm khác đính kết trung tâm bất đối xứng Hóa chất hoạt tính hình học? Some Important Classes of Organic Reactions (Sample Problem 15.3) 15.34 Write equations for the following: (a) an addition reaction between HjO and 3-hexene (H+ is required and shown above the yield arrow); (b) an elimination reaction between 2-bromo- propane and hot potassium ethoxide, CH 3—CH2—OK (KBr and ethanol are also products); (c) a light-induced substitution reaction between Cl and ethane to form 1,1 -dichloroethane 15.35 Write equations for the following: (a) a substitution reaction between 2-bromopropane and KI; (b) an addition reaction between cyclohexene and Cl 2; (c) an addition reaction between 2-propanone and H2 (Ni metal is required and shown above the yield arrow) 15.36 Phenylethylamine is a natural substance that is structurally similar to amphetamine It is found in sources as diverse as almond oil and human urine, where it occurs at elevated concentrations as a result of stress and certain forms of schizophrenia One method of synthesizing the compound for pharmacological and psychiatric studies involves two steps: C6H5CH2Cl + NaCN → C6H5CH2CN → C6H5CH2CH2NH2 Classify each step as an addition, elimination, or substitution Một vài loại phản ứng hữu điển hình (Bài tập 15.3) 15.32 Xác định loại phản ứng câu bên dưới: 15.33 Xác định loại phản ứng câu bên dưới: 15.34 Viết phương trình hóa học cho câu bên dưới: (a) phản ứng cộng H2O 3-hexen (H+ chất xúc tác đặt mũi tên); (b) phản ứng tách 2-bromo-propan kalietylat đun nóng, CH 3-CH2-OK (KBr etanol chất sản phẩm); (c) phản ứng Cl2 etan tạo 1,1-dichloroetan, ánh sáng 15.36 Viết phương trình hóa học cho câu bên dưới: (a) phản ứng 2-bromopropane KI (b) phản ứng cộng cyclohexene Cl2 (c) phản ứng cộng 2-propanone H2 15.36 Phenyletylamin chất tự nhiên cấu trúc với amphetamin Nó tìm thấy từ nguồn khác dầu hạnh nhân nước tiểu người, nơi xuất việc tập trung cao độ cao kết căng thẳng dạng định tâm thần phân liệt Phương pháp tổng hợp hợp chất cho nghiên cứu dược lý tâm thần học gồm hai bước sau: Phân loại bước thành phản ứng cộng, phản ứng tách, phản ứng Properties and Reactivities of Common Functional Groups (Sample Problems 15.4 to 15.6) 15.37 Compounds with nearly identical molar masses often have very different physical properties Choose the compound with the higher value for each of the following properties, and explain your choice (a) Solubility in water: chloroethane or methylethylamine (b) Melting point: diethyl ether (CJHJ—O—CJH5) or 1-butanol (c) Boiling point: trimethylamine or propylamine 15.38 Fill in each blank with a general formula for the type of compound formed: H2O, H+ R CH CH2 HBr CH3O H+ OH HBr 15.39 Why does the C=0 group react differently from the C=C group? Show an example of 15.40 15.41 15.42 15.43 the difference Many substitution reactions are initiated by electrostatic attraction between reactants Show where this attraction arises in the formation of an amide from an amine and an ester What reaction type is common to the formation of esters and acid anhydrides? What is the other product? Both alcohols and carboxylic acids undergo substitution, but the processes are very different Explain Name the type of organic compound from each description of the functional group: (a) polar group that has only single bonds and does not include O or N; (b) group that is polar and has a triple bond; (c) group that has single and double bonds and is acidic in water; (d) group that has a double bond and must be at the end of a C chain 15.44 Name the type of organic compound from each description of the functional group: (a) N-containing group with single and double bonds; (b) group that is not polar and has a double bond; (c) polar group that has a double bond and cannot be at the end of a C chain; (d) group that has only single bonds and is basic in water 15.45 Circle and name the functional group(s) in each compound: 15.46 Circle and name the functional group(s) in each compound: 15.47 Draw all alcohols with the formula C3H120 15.48 Draw all aldehydes and ketones with the formula C 3H10O 15.49 Draw all amines with the formula C4H,,N 15.50 Draw all carboxylic acids with the formula CsH10O2 15.51 Draw the organic product formed when the following compounds undergo a substitution reaction: (a) acetic acid and methyl- amine; (b) butanoic acid and 2propanol; (c) formic acid and 2-methyl-1 -propanol 15.52 Draw the organic product formed when the following compounds undergo a substitution reaction: (a) acetic acid and 1-hexanol; (b) propanoic acid and dimethylamine; (c) ethanoic acid and diethylamine 15.53 Draw condensed formulas for the carboxylic acid and alcohol that form the following esters 15.54 Draw condensed formulas for the carboxylic acid and amine that form the following amides 15.55 Fill in the expected organic substances 15.56 Fill in the expected organic substances 15.57 (a) Draw the four isomers of C 5H12O that can be oxidized to an aldehyde, (b) Draw the three isomers of C5H12O that can be oxidized to a ketone, (c) Draw the isomers of C5H120 that cannot be easily oxidized to an aldehyde or ketone, (d) Name any isomer that is an alcohol 15.58 Ethyl formate (HCOO—CH2—CH3) is added to foods to give them the flavor of rum How would you synthesize ethyl formate from ethanol, methanol, and any inorganic reagents? Tính chất phản ứng hóa học cá nhóm chức thường gặp (Bài tập 15.4 đến 15.6) 15.37 Các hợp chất khối lượng phân tử gần thường nhiều tính chất vật lý khác Hãy chọn hợp chất giá trị cao cho câu tính chất hóa học bên dưới, giải thích bạn lại chọn (a) Hòa tan nước: chloroethane metyletylamin (b) Độ tan chảy: dietyl ether (C2H5-O-C2H5) 1-butanol (c) Độ sôi: trimetylamin propylamin 15.38 Điền vào chỗ trống công thức chung cho loại hóa chất hình thành đây: 15.39 Tại nhóm C=O phản ứng khác với nhóm C=C? Đưa ví dụ khác 15.40 Nhiều phản ứng bắt đầu việc hút tĩnh điện chất phản ứng Hãy vị trí lực hút phát sinh trình hình thành amit amin este 15.41 Loại phản ứng thường dùng trình hình thành este axit anhydrit? Chất sản phẩm gì? 15.42 Cả alcohol axit cacboxylic trải qua phản ứng thế, trình khác nhau, giải thích 15.43 Nêu tên loại hợp chất hữu từ câu mô tả nhóm chức sau đây: (a) nhóm phân cực liên kết đơn nhất, không chứa O N; (b) nhóm không phân cực chứa liên kết ba; (c) nhóm liên kết đơn liên kết đôi tính axit nước; (d) nhóm liên kết đôi phải nằm cuối chuỗi C 15.44 Nêu tên loại hợp chất hữu từ câu mô tả nhóm chức sau đây: (a) nhóm chứa N liên kết đơn liên kết đôi, không chứa O N; (b) nhóm không phân cực chứa liên kết đôi; (c) nhóm phân cực liên kết đôi nằm cuối chuỗi C; (d) nhóm liên kết đơn tính bazơ nước 15.45 Khoanh tròn gọi tên (các) nhóm chức hợp chất dưới: 15.46 Khoanh tròn gọi tên (các) nhóm chức hợp chất dưới: 15.47 Viết cấu tạo tất alcohol công thức C5H12O 15.48 Viết cấu tạo tất anđêhit xeton công thức C 5H10O 15.49 Viết cấu tạo tất amin công thức C4H11N 15.50 Viết cấu tạo tất axit cacboxylic công thức C5H10O2 15.51 Viết chất sản phẩm hữu hình thành hợp chất bên trải qua phản ứng thế: (a) axit acetic 1-hexanol; (b) axit propanoic dimetylamin; (c) axit etanoic dietylamin 15.53 Viết công thức cấu tạo thu gọn cho axit cacboxylic alcohol hình thành từ este bên dưới: (a), (b), (c) 15.54 Viết công thức cấu tạo thu gọn cho axit cacboxylic amin hình thành từ amit bên dưới: (a), (b), (c) 15.55 Điền vào ô trống chất hữu phù hợp: (a), (b) 15.56 Điền vào ô trống chất hữu phù hợp: (a), (b) 15.57 Viết bốn đồng phân C 5H12O mà oxi hóa với anđêhit (b) Viết ba đồng phân C5H12O mà oxi hóa với xeton (c) Viết đồng phân C5H12O mà dễ dàng bị oxi hóa anđehit xeton (d) Kể tên đồng phân alcohol 15.58 Etyl fotmat thêm vào thức ăn để khiến chúng hương vị rượu rum Bạn làm cách để tổng hợp focmat etyl từ etanol, metanol, thuốc thử vô bất kì? The Monomer-Polymer Theme I: Synthetic Macromolecules 15.59 Name the reaction processes that lead to the two types of synthetic polymers 15.60 Which functional group occurs in the monomers of addition polymers? How are these polymers different from one another? 15.61 Which intermolecular force is primarily responsible for the different types of polyethylene? Explain 15.62 Which of the two types of synthetic polymer is more similar chemically to biopolymers? Explain 15.63 Which functional groups react to form nylons? Polyesters? 15.64 Draw an abbreviated formula for the following polymers, with brackets around the repeat unit: (a) Polyfvinyl chloride) (PVC) from CH2=CH-Cl (b) Polypropylene from CH2=CH-CH3 15.65 Draw an abbreviated formula for the following polymers, with brackets around the repeat unit: (a) Teflon from CF2=CF2 (b) Polystyrene from C6H5CH=CH2 15.66 Write a balanced equation for the reaction between 1,4- benzenedicatboxylic acid and 1,2-dihydroxyethane to form the polyester Dacron Draw an abbreviated structure for the polymer, with brackets around the repeat unit 15.67 Write a balanced equation for the reaction of dihydroxydimethylsilane (right) to form the condensation polymer sold as Silly Putty CH3 HO Si OH CH3 Đại cương polime-monome phần 1: Cao phân tử tổng hợp 15.59 Kêt tên trình phản ứng tạo hai loại polime tổng hợp 15.60 Nhóm chức xuất monome phản ứng trùng cộng? Những loại polime khác với loại nào? 15.61 Lực phân tử chịu trách nhiệm chủ yếu loại polyetylen? Hãy giải thích 15.62 Loại số hai loại polime tổng hợp tính hóa học giống với polime sinh học nhất? Hãy giải thích 15.63 Nhóm chức phản ứng cho dạng nilon? Polyeste? 15.64 Vẽ công thức viết tắt cho nhựa quan sát, với ngoặc đơn quanh vị trí lập lại : (a) Poly(vinyl chloride) (PVC) từ (b)Polypropylene từ 15.65 Vẽ công thức viết tắt cho nhựa quan sát, với ngoặc đơn quanh vị trí lập lại : (a) Teflon từ (b) Polystyrene từ 16.66 Viết phương trình cân cho phản ứng 1.4 axit benzenedicarboxylic với 1.2- dihydroxyethane để tạo thành polieste Dacron Bản vẽ cấu trúc ngắn gọn cho Polime, Với ngoặc đơn quanh vị trí lập lại 15.67 Bản vẽ phương trình cân cho phản ứng dihydroxymethylsilane (phải) để tạo thành ngưng tụ polime bán cho Silly Putty The Monomer-Polymer Theme II: Biological Macromolecules 15.68 Which type of polymer is formed from each of the following monomers: (a) amino 15.69 15.70 15.71 15.72 15.73 15.74 15.76 15.77 acids; (b) alkenes; (c) simple sugars; (d) mononucleotides? What is the key structural difference between fibrous and globular proteins? How is it related, in general, to the proteins’ amino acid composition? Protein shape, function, and amino acid sequence are interrelated Which determines which? What is base pairing? How does it pertain to DNA structure? Draw the R group of (a) alanine; (b) histidine; (c) methionine Draw the R group of (a) glycine; (b) isoleucine; (c) tyrosine Draw the formula of each of the following tripeptides: (a) Aspartic acid-histidine-tryptophan (b) Glycine-cysteine-tyrosine with the charges that exist in cell fluid 15.75 Draw the formula of each of the following tripeptides: (a) Lysine-phenylalanine-threonine (b) Alanine-leucine-valine with the charges that exist in cell fluid Write the sequence of the complementary DNA strand that pairs with each of the following DNA base sequences: (a) TTAGCC (b) AGAC AT Write the sequence of the complementary DNA strand that pairs with each of the following DNA base sequences: (a) GGTTAC (b) CCCGAA 15.78 Protein shapes are maintained by a variety of forces that arise from interactions between the amino-acid R groups Name the amino acid that possesses each R group and the force that could arise in each of the following interactions: (a) —CH2—SH with HS—CH2— (b) —(CH2)4—NH3+ with (c) —CH2—CO—NH2 with HO—CH2— (d) —CH—CH3 - OO—C—CH2— with C6H5—CH2— CH3 15.79 Amino acids have an average molar mass of 100 g/mol How many bases on a single strand of DNA are needed to code for a protein with a molar mass of 5X10 g/mol? Đại cương polime-monome phần 2: Cao phân tử sinh học 15.68 Loại polyme tạo thành từ đơn phân quan sát: (A) amino axit ; (b) anken ; (c) đường đơn ; (d) phân tữ vĩ mô? 15.69 Sự khác biệt cấu trúc chủ yếu chất xơ protein dạng cầu gì? Nó liên quan nào,nói chung để tổ hợp amino axit protein? 15.70 Hình dạng, chức năng, dãy amino axit protein tương quan với Xác định tương quan với nào? 15.71 ghép sở gì? Nó liên quan đen cấu trúc AND nào? 15.72 Bản vẽ nhóm R (a) a-la-nin ;(b) histidine ; (c)methionine 15.73 Bản vẽ nhóm R (a) glycine ;(b) isoleucine ; (c)tyrocine 15.74 Viết công thức cho tripeptides quan sát: (a) Aspartic axit- histidine-tryptophan (b) Glycine-cysteine-tyrocine với việc nạp điện tồn dịch tế bào 15.75 Viết công thức cho tripeptides quan sát: (a) Lycine-phenylalanine-threonine (b) Alanine-leucine-valine với việc nạp điện tồn dịch tế bào 15.76 Viết dãy chuổi DNA bổ sung ghép cặp với dãy DNA sở quan sát: (a)TTAGCC (b) AGACAT 15.77 Viết dãy chuổi DNA bổ sung ghép cặp với dãy DNA sở quan sát: (a) GGTTAC (b) CCCGAA 15.78 Hình dạng protein trì lực khác mà sinh từ phản ứng nhóm R amino axit Tên amino axit chiếm hữu nhóm R lực sinh phản ứng quan sát: 15.79 Các amino axit khối lượng phân tử trung bình 100g/mol amino axit dựa chuổi đơn DNA cần để viết mã cho protein với khối lượng phân tử trung bình x 105g/mol? Comprehensive Problems 15.80 A synthesis of 2-butanol was performed by treating 2-bromobutane with hot sodium hydroxide solution The yield was 60%, indicating that a significant portion of die reactant was converted into a second product Predict what this other product might be 15.81 Pyrethrins, such as jasmolin II (below), are a group of natural compounds synthesized by flowers of the genus Chrysanthemum (known as pyrethrum flowers) to act as insecticides (a) Circle and name the functional groups in jasmolin n (b) What is the hybridization of the numbered carbons? (c) Which, if any, of the numbered carbons are chiral centers? 15.82 Compound A is branched and optically active and contains C, H, and O (a) A 0.500-g sample bums in excess O to yield 1.25 g of CO2 and 0.613 g of H20 Determine the empirical formula (b) When 0.225 g of compound A vaporizes at 755 torr and 97°C , the vapor occupies 78.0 mL Determine the molecular formula (c) Careful oxidation of the compound yields a ketone Name and draw compound A, and circle the chiral center 15.83 The genetic code consists of a series of three-base words that each code for a given amino acid (a) Using the selections from the genetic code shown below, determine the amino acid sequence coded by the following segment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG = methionine CCU = proline CAU “ histidine UGG = tryptophan AAG = lysine UAU = tyrosine GCC = alanine UUG =leucine CGG = arginine UGU = cysteine AAC = asparagine ACA = threonine UCC = serine GCA =alanine UCA = serine (b) What is the complementary DNA sequence from which this RNA sequence was made? (Hint: Uracil, U, in RNA pairs with adenine, A, in DNA) 15.84 Sodium propanoate (CH3—CH2—COONa) is a common preservative found in breads, cheeses, and pies How would you synthesize sodium propanoate from 1propanol and any inorganic reactants? 15.85 Supply the missing organic and/or inorganic substances: Cl CH3 CH Br CH3 ? CH3 CH ? CH2 CH3 CH Br CH2 O CH3 CH2 CH2 OH ? CH3 CH2 C ? OH ? O CH3 CH2 C O CH2 Các vấn đề toàn diện 15.80 Sự tổng hợp butanol thực việc xử lý 2-bromobutane với trình làm nóng Na-tri hi-dro-xit SẢn lượng 60%, phần quan trọng chất phản ứng biến đổi thành chất tạo thành Dự đoán sản phẩm tạo thành khác trường hợp gì? 15.81 Pyrethrins, jasmolin (dưới) nhóm hợp chất tự nhiên tổng hợp hoa loại hoa cúc ( biết hoa cúc nhỏ) để phản ứng thuốc trừ sâu (a) Khoanh tròn tên nhóm chức jasmolin II (b) Sự lai giống số lượng carbon gì? (c) số lượng carbon trung tâm bất đối?? 15.82 Phức hợp A phân chia quang học tích cực bao gồm C, H O (a) A 0.500-g mẫu đốt cháy bị dư thừa O để tao 1.25g CO va 0.613 g H2O Việc xác định công thức thí nghiệm (b) 0.225 g hợp chất A bi bốc 755torr CÁch làm bốc chieems.0 mL XÁc định công thức phân tử (c) quan tâm đến ô-xi hóa hợp chất tạo xeton Nêu tên Bản vẽ Hợp chất A, khoanh tròn trung tâm bất đối 15.83 Mã di truyền dãy gồm ba tuwfmaf mã amino axit định (a) Sử dụng lựa chọn từ mã di truyền để định bên dưới, xác định mã dãy amino axit cấc đoạn RNA định: AUG UGG GCC UGU = methionine = tryptophan = alanine = cysteine CCU AAG UUG AAC = proline = lysine = leucine = asparagine CAU UAU CGG ACA = histidine = tyrosine = arginine = threonine UCC = serine GCA = alantine UCA = serine 15.84 Natri propan chất bảo quản phổ biến tìm thấy bánh mì,phô mai, bánh quy Bạn làm để tạo Natri propan từ 1- propanol chất phản ứng vô 15.85 Cung cấp chất hữu bị hay chất vô cơ: Cl CH3 CH Br CH3 ? CH3 CH ? CH2 CH3 CH Br CH2 O CH3 CH2 CH2 OH ? CH3 CH2 C ? OH ? O CH3 CH2 C O CH2 ... ô trống chất hữu phù hợp: (a), (b) 15.56 Điền vào ô trống chất hữu phù hợp: (a), (b) 15.57 Viết bốn đồng phân C 5H12O mà oxi hóa với anđêhit (b) Viết ba đồng phân C5H12O mà oxi hóa với xeton... hợp chất hữu (b) Nguyên tố nguyên tử khác loại? (c) Nguyên tố có độ âm điện lớn cacbon? nguyên tố hơn? (d) Tại liên kết cacbon với nguyên tử khác loại làm tăng số lượng hợp chất hữu cơ? 15.3... hoạt tính hình học Khoanh tròn (các) trung tâm đối xứng câu: 15.20 Mỗi hợp chất bên có hoạt tính quang học Khoanh tròn (các) trung tâm đối xứng câu: (a) (b) 15.21 Viết cấu tạo danh pháp đây, xác

Ngày đăng: 30/06/2017, 21:54

Từ khóa liên quan

Tài liệu cùng người dùng

  • Đang cập nhật ...

Tài liệu liên quan