Mechanism based modeling of ductile void growth failure in multilayer structures
MÔ HìNH HOá QUá TRìNH TRAO ĐổI NHIệT ẩM TRONG MáY ấP TRứNG GIA CầM Modeling of heat and mass transfer in chicken egg incubators
... 3.4 Mô hình toán học trình trao đổi nhiệt ẩm vùng chứa trứng Từ mô hình động học (6) phơng trình nhiệt độ độ ẩm dòng khí trứng (35), (36) (38) ta xác định đợc hệ phơng trình mô tả trạng thái nhiệt ... lợng trứng: 224 (1 ) drT h fT t = hcTa Av (Ta TT ) + (1 ) drT hP + (1 ) drT hD (TT ) X t (34) 3.3 Đơn giản hoá mô hình nhiệt ẩm vùng chứa trứng Mô...
Ngày tải lên: 28/08/2013, 08:31
Tài liệu Understanding Growth Failure in Children With Homozygous Sickle-Cell Disease doc
... examine the etiology of growth failure in children with homozygous SCD The electronic databases searched include Cochrane, Medline/PubMed, and Cinahl Search terms used SCD combined with homozygous, ... homozygous, growth, height, weight, body mass index, and nutrition Growth Failure There are main factors that have been found to contribute to growth failure in chil...
Ngày tải lên: 12/02/2014, 19:20
Dynamics in Human and Primate Societies: Agent-Based Modeling of Social and Spatial Processes pdf
... Dynamics in Human and Primate Societies: Agent-Based Modeling of Social and Spatial Processes This page intentionally left blank DYNAMICS IN HUMAN AND PRIMATE SOCIETIES Agent-Based Modeling of ... corporate software gambit, this technology is in fact provoking great interest in the possibilities of simulating social, spatial, and evolutionar...
Ngày tải lên: 14/03/2014, 21:20
Rating Based Modeling of Credit Risk: Theory and Application of Migration Matrices doc
... the rating agencies provide two different sorts of ratings: • Issue-specific credit ratings and • Issuer credit ratings Issue-specific credit ratings are current opinions of the creditworthiness of ... theory and application of migration matrices in rating based credit risk models In the last decade, rating based models in credit risk management have becom...
Ngày tải lên: 22/03/2014, 23:20
Báo cáo khoa học: "PCR-based detection of genes encoding virulence determinants in Staphylococcus aureus from bovine subclinical mastitis cases" doc
... :drawrof CGAAATCAAGCAGTTCCGAACGCA :esrever TTGGCATAGTGGTAGTTAGC :drawrof TACAGCAATTTGGACCAC :esrever AAGGAGAAAACCACGAAC :drawrof CTCCTTCTGTTGTTGTTCGG :esrever GCGTCGTAAACGTCGTCCAC :drawrof CGTAGCTTGTTAGCCTTCG ... )1 : 42( lohocla lymaosi :mroforolhc dna )1 : 1( mroforolhc :lonehp htiw noitcartxe yb deifirup saw AND Co56 ta nim 03 rof detabucni dna )lCaN M 7.0 ni edimorb muinomma lyhtemirt lyc...
Ngày tải lên: 07/08/2014, 20:23
Báo cáo lâm nghiệp: "DNA-based control of oak wood geographic origin in the context of the cooperage industry" ppsx
... al the effect of the geographic origin of oak wood on wines is the subject of many discussions and experimentations throughout the world [10, 13, 14], along with the influence of barrel making ... to test if the combination of haplotypes found in the 11 wood lots analysed in this study were conforming to a French origin Each wood lot corresponded to a...
Ngày tải lên: 08/08/2014, 01:22
Báo cáo khoa học: "Carbon-based models of individual tree growth: A critical appraisal" ppsx
... Using a constant R/P ratio could be a more simple and accurate way of modelling respiration than the growth-maintenance paradigm, at least for computing whole tree carbon balance at an annual time ... represent individual branches However, this strong assumption does not allow an accurate representation of the actual location and topological characteristics of tree organs An i...
Ngày tải lên: 08/08/2014, 14:21
Báo cáo khoa học: "Differences of genetic variation based isozymes of primary and secondary metabolism in Quercus petraea" ppt
... each point and Allozymes studied in population surveys usually correspond to enzymes involved in primary and secondary metabolism The objective of this study was to evaluate levels of within-population ... Frankfurt-am-Main, 167-172 Müller-Starck G, Ziehe M (1991) Genetic variation in populations of Fagus sylvatica L, Quercus robur L, and Q petraea Liebl in Ger...
Ngày tải lên: 08/08/2014, 19:21
Báo cáo y học: "Reactive oxygen species induce expression of vascular endothelial growth factor in chondrocytes and human articular cartilage explants" pps
... changes in biosynthetic activity [15], in addition to apoptosis [16] In addition, ROS can influence transcription factors in chondrocytes and induce the expression of catabolic cytokines [17] ... necessary to investigate the signal transduction pathways of PMA and SIN-1 in chondrocytes Conclusion By amplifying distinct ROS-dependent destructive pathways in cartila...
Ngày tải lên: 09/08/2014, 08:23
Báo cáo y học: " Protective role of vascular endothelial growth factor in endotoxin-induced acute lung injury in mice" potx
... examining both endothelial permeability and apoptosis in a single model of lung injury To evaluate the role of VEGF in the apoptosis of endothelial cells and their barrier function in the injured ... pathophysiology of a murine model of acute lung injury Am J Physiol 2002, 283:L585-L595 Kaner RJ, Crystal RG: Compartmentalization of vascular endothelial g...
Ngày tải lên: 12/08/2014, 15:21
the value of switching and growth options in foreign direct investmentl
... real options The purpose of this dissertation is to address these problems in the multinational flexibility literature In the main essay, Growth and Switching Options in Foreign Direct Investments,’ ... examine in greater depth the two important perspectives of real options associated with foreign direct investments, growth and switching We show th...
Ngày tải lên: 02/11/2014, 00:48
Econophysics and agent based modeling of financial market
... Econophysics and Agent- Based Modeling of Financial Market FENG LING (B.Sc.(Hons), National University of Singapore) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY NUS ... interacting agents, the models are named agent- based models In this work, agent behaviors are gathered through empirical evidence and theoretical intuition, and an agent- based m...
Ngày tải lên: 10/09/2015, 09:09
Modeling of ductile mode machining of brittle materials for endmilling
... MODELING OF DUCTILE- MODE MACHINING OF BRITTLE MATERIALS FOR END-MILLING MUHAMMAD ARIF (B Sc Industrial and Manufacturing Engineering) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY ... critical feed per edge for ductile- brittle transition in milling process of brittle materials 4.1 Mechanism of ductile machining for endmilling 4.2 Devel...
Ngày tải lên: 10/09/2015, 15:48
Mechanism based modeling of ductile void growth failure in multilayer structures
... many in the field of ductile void growth modeling However, void pressure-assisted ductile crack growth remains relatively new in this area Thus investigations begin with a preliminary study in ... Summary Of Conclusions 142 iv Table of Contents 7.1 Ductile Crack Growth under Small Scale Yielding 142 7.2 Ductile Failure of Centerline Crack in a Constrained...
Ngày tải lên: 10/11/2015, 12:35