REPRODUCTION IN FLOWERING PLANTS

... radiolabel in eggs is difficult to interpret quantitatively Naturally occurring variation in stable carbon isotopes provides a potential solution to the difficulties inherent in nutrient labeling ... dietary sugars into eggs by analyzing egg 13C content across a female’s lifetime In addition, we use an isotopically distinct amino acid supplement to address whether nectar...

Ngày tải lên: 13/02/2014, 16:20

... F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b ... DNA binding and chromatin association of ATR (ataxia telangiectasia-mutated and Rad3-related) in vitro via ATR interacting protein [4,22,23] Rad17 and Rad9 complexes (Rad17–RFC...

Ngày tải lên: 07/03/2014, 21:20

... Biochemical Mechanisms of Detoxification in Higher Plants George Kvesitadze · Gia Khatisashvili Tinatin Sadunishvili · Jeremy J Ramsden Biochemical Mechanisms of Detoxification in Higher Plants ... most vitally important parameters determining the continuing existence of mankind The inexorable and seemingly permanent increase of technogenic contaminants in all e...

Ngày tải lên: 16/03/2014, 18:07

... co-ordination of Chl might be in part different in PSI and in PSII; PSI binds Chls both within individual pigment binding proteins and at the interface between subunits In PSII, Chls are tightly ... absorption spectroscopy (Fig 4A) and SDS/PAGE analysis (not shown) and identified as: (i) free pigments; (ii) dimeric LHCI; (iii) PSI-core and (iv) undissociated PSI LHCI com...

Ngày tải lên: 30/03/2014, 15:20

... heterologous secretory proteins We therefore studied the involvement of BiP and calreticulin in the folding and assembly of recombinant immunoglobulin heavy and light chains in transgenic plants that ... when increasing amounts of light chain are available for IgG assembly The association of BiP with folding and assembly of recombinant immunoglobulin chains in plants is sign...

Ngày tải lên: 31/03/2014, 08:20

... The USE of NUTRIENTS in CROP PLANTS The USE of NUTRIENTS in CROP PLANTS N.K Fageria Boca Raton London New York CRC Press is an imprint of the Taylor & Francis Group, an informa business ... special-purpose use of crops are catch crops, cover crops, and green manure crops The importance of these crops in soil-amelio­ rating practice is increasing in...

Ngày tải lên: 03/04/2014, 12:10

... concanavalin A-peroxidase reaction allowed the visualization of 15 stigmatic and pollinic glycoproteins according Differences to the glycoprotein type of increases were observed, distinct in the compat- ... to the presence of P nigra and P alba pollen tubes inside stigmatic tissues However, increasing protein bands were detectable, 0-20 h after pollination, only in compa...

Ngày tải lên: 09/08/2014, 04:20

... components in the pollen coat is observed within the arcades of the exine (Fig 2) These components also reactive in the polysaccharide and glycoconjugate detection test (Gaget, 1988) These components ... across the pollen wall by means of canaliculi whose diameter was estimated to be 30 nm Protein assay showed that, depending upon the species used, 5-20% of the pol...

Ngày tải lên: 09/08/2014, 04:20

... transgenic plants causes growth anomalies by disrupting brassinosteroid signaling Kasturi Dasgupta1, Savita Ganesan2, Sindhu Manivasagam1 and Brian G Ayre1* Abstract Background: Cytochrome P450 ... (5’-AGTAAGGTACCTCATCAGATTTCGG TGACG-3’) and BARHind5 (5’-TTACTAAGCTTAAC AATGAGCCCAGAACGACG-3’) The amplified product was ligated to itself and used as the template for PCR w...

Ngày tải lên: 11/08/2014, 11:22

... added into the tool box of red fluorescent proteins for use in plants Methods In addition, the plasmids created in the course of this work are convenient tools for the investigation of the subcellular ... of the red and the green fluorescence in these protoplasts confirmed the co-expression of both proteins in the same cell (Fig 3) In addition to the GF...

Ngày tải lên: 12/08/2014, 05:20

... mammals and yeast, is not straightforward in plants Similarly, studying cooperative TFBSs within regulatory modules also suffers from the inclusion of potentially false-positives when selecting genes ... identified using twoway clustering Additional data file is a table giving an overview of the 139 cis -regulatory modules Additional data file is a table showing the mot...

Ngày tải lên: 14/08/2014, 17:22

... are present in offspring of the old parents Similarly, the high late reproduction in offspring of the old parents would not be causally related to their low early reproduction effort (Partridge, ... mm All the beans were brought in bulk at one time from one source Density dependent selection The following summarizes the method of selection used to obt...

Ngày tải lên: 14/08/2014, 20:20

Ngày tải lên: 14/11/2014, 09:20

... EFFECTIVE FAULT DIAGNOSIS IN CHEMICAL PLANTS BY INTEGRATING MULTIPLE METHODOLOGIES KAUSHIK GHOSH (B Tech., University of Calcutta, India) (M.S (by Research), IIT Madras, India) A THESIS ... detecting and identifying faults in large-scale, complex, modern chemical plants Then a review of multiple classifiers systems (MCS), used in pattern recognition, fault cla...

Ngày tải lên: 09/09/2015, 17:52

... 5-10: Operating state identification by OSINN-P in air blower section 131 Figure 5-11: Operating state identification by OSINN-S in air blower section 132 Figure 5-12: Operating state identification ... Fault detection by OSINN-N 143 Figure 5-21: Operating state identification by OSINN-P in P pastoris 145 Figure 5-22: Operating state identification by OSINN-N in P...

Ngày tải lên: 16/09/2015, 12:29