isolation, selection and identification bacillus subtilis from muddreg of beer

... the subject of Bacillus subtilis isolated from waste water of beer and beer wallows in the brewing process Objective: Isolation, selection and identification of Bacillus subtilis from beer dregs, ... band of strains and Bacillus subtilis control had 1500bp Sequencing perform that strains (Bs4 and BN5) were Bacillus subtilis (99% and 98% identi...

Ngày tải lên: 06/10/2015, 12:58

... exclusively of AATs from prokaryotes, including AATs from proto- Identification of a new aspartate aminotransferase zoa, archaebacteria and bacteria Interestingly, plants also have Ib subgroup-prokaryote-type ... mean ± SD of three determinations B subtilis B3 AATB3 Substrates L -aspartate L-glutamate a- ketoglutarate Oxaloacetate Fig Characterization of the purifi...

Ngày tải lên: 14/03/2014, 23:20

... KRDmsAF (CGGTATTGG CTGCTGAGGTGAGTAAACGTGGTTTGG) and KRD- msAR (CCAAACCACGTTTACTCACCTCAGCAGCCA ATACCG) for KR mutation; RKDmsAF (GCTGCTGAG GTGAGTCGCAAAGGTTTGGTAAAAACG) and RKDmsAR (CGTTTTTACCAAACCTTTGCGACTCACCTC ... (CGTTTTTACCAAACCTTTGCGACTCACCTC AGCAGC) for RK mutation; and KRtoKKDmsAF (GCTGAGGTGAGTAAAAAGGGTTTGGTAAAAACG ACAGCG) and KRtoKKDmsAR (CGCTGTCGTTT TTACCAAACCCTTTTTACTCACCTCAG...

Ngày tải lên: 16/03/2014, 04:20

... proteins from B subtilis and E coli Results and Discussion NadA cloning and protein purification and characterization In order to optimize the heterologous production and purification of B subtilis ... enzyme from E coli [9], NadB from B subtilis is a dimer of 115 kDa in the absence of NaCl and a monomer of 55 kDa in the presence of 150 mm NaCl After incubati...

Ngày tải lên: 30/03/2014, 02:20

... Therefore, isolation and identification of a potential viral pathogen was pursued Canine coronavirus was first isolated from a case of canine enteritis during an epizootic in Germany in 1971 Later, ... Howard J, Montali RJ, Hayek LA, Dubovi E, Zhang Z, Yan Q, Guo W, Wildt DE Serosurvey of ex situ giant pandas (Ailuropoda melanoleuca) and red pandas (Ailurus...

Ngày tải lên: 07/08/2014, 23:22

... Evaluation of antioxidant activities of fractions to isolated from Ixeris sonchifolia Hance extract 44 2.4 Discussion and conclusions Chapter Isolation and characterization of components from ethyl ... Possible anti- coagulation activities of fractions to isolated from Ixeris sonchifolia Hance extract 42 2.3.2 Effects of fractions to isolated from Ixeri...

Ngày tải lên: 11/09/2015, 10:06

... 2011 FEBS S Cuyvers et al Secondary substrate binding in GH11 xylanases Table The effect of genetic engineering of the secondary binding site of the B subtilis and A niger xylanases on the screening ... ª 2011 FEBS 1101 Secondary substrate binding in GH11 xylanases S Cuyvers et al Table Biochemical characterization of B subtilis and A niger xylan...

Ngày tải lên: 14/02/2014, 19:20

... orthologs of the type I isomerase Highest degrees of similarity were found to Idi-1 proteins of the c-proteobacteria A vinelandii and P luminescens and to Idi-1 protein of the Bacteroid C hutchinsonii ... Halobacterium sp NRC-1, Mycobacterium marinum and Photorhabdus luminescens featuring both a putative idi-1 and a putative idi-2 gene, the distribution of type I and...

Ngày tải lên: 19/02/2014, 13:20

... concentrations on GlnK binding to TnrA GlnK TnrA interaction in the presence of mm ATP On the other hand, 2-oxoglutarate did not in uence the GlnK TnrA interaction, either alone, in the absence of divalent ... interaction of truncated TnrA proteins with GlnK and GS (A) BIAcore analysis of GlnK and GS binding to wild-type TnrA (TnrAwt), TnrA6 ,...

Ngày tải lên: 06/03/2014, 00:21

... that GO and DAAO oxidize D-proline, D-alanine and D-2-aminobutyrate with similar relative efficiencies Analogously, GO and MSOX show a fairly similar activity on sarcosine and N-ethylglycine In ... possesses a wide substrate specificity In addition to sarcosine and glycine, even N-ethylglycine, ethylglycine ester, D-alanine, D-2-aminobutyrate, D-proline, D-pipecolate and N-...

Ngày tải lên: 08/03/2014, 16:20

... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R, 5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GTcDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTAC CTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTT CCAAGTGC-3¢ for GT-cDNA2 (3043 bp) RNA isolation and ... revealed two putative polyadenylation (ATTAAA) signals: one is located 18 bp upstream from the poly (A) of GT-cDNA1 and another is located 11 bp upstream from...

Ngày tải lên: 17/03/2014, 03:20

... asymmetric unit, and the glutamate- binding modes are identical to each other (Fig 2A) The a- carboxyl and a- amino groups of the bound glutamate are at the bottom of the pocket, and are held in this position ... was amplified by PCR from the plasmid pCY167 (Suzuki H & Yamada C, Unpublished), using forward primer 5¢-CATATGGATGAGTACAAACA AGTAGATG-3¢ and reverse primer...

Ngày tải lên: 22/03/2014, 21:20