báo cáo hóa học: " A rehabilitation tool for functional balance using altered gravity and virtual reality" potx

... Shimada K, Iwasaka T, Imaizumi T: Therapeutic angiogenesis for patients with limb ischaemia by autologous transplantation of bone- marrow cells: a pilot study and a randomised controlled trial. Lancet ... 360(9331):427-435. 14. Miyamoto K, Nishigami K, Nagaya N, Akutsu K, Chiku M, Kamei M, Soma T, Miyata S, Higashi M, Tanaka R, Nakatani T, Nonogi H, Take- shita S: Unblinded pilot stud...

Ngày tải lên: 18/06/2014, 15:20

... willex to a large-scale HPSG-style grammar as an example. 1 Introduction There is an increasing need for syntactical parsers for practical usages, such as information extrac- tion. For example, Yakushiji ... 4-1-8, Kawaguchi-shi, Saitama 332-0012 JAPAN {akane,yucca,yusuke,yoshinag,tsujii}@is.s.u-tokyo.ac.jp Naoki Yoshinaga† Jun’ichi Tsujii†‡ Abstract We have developed willex, a too...

Ngày tải lên: 08/03/2014, 04:22

... Examples and Frames tab. Frames specify the syntactic valence of a lexical unit. Each frame can have an associated example that indicates a possible us- age of the lexical unit for that particular ... particular frame. The tab Examples and Frames is thus particu- larly geared towards the editing of verb entries. By clicking on the tab all examples and frames of a lexical un...

Ngày tải lên: 17/03/2014, 00:20

... proposal and can freely modified by the validator, as explained hereafter. Before starting the interface, the validator can also choose whether to add a virtual annotator a SSI to the set of annotators ... phase. The tool can indeed provide richer information than interfaces like the Open Mind Word Expert (Chklovski and Mihalcea, 2002), and the annotator can take ad- vantage of t...

Ngày tải lên: 31/03/2014, 01:20

... study, participated in the design, statistical analyses of the study and helped to draft the manuscript. All authors read and approved the final manuscript. Additional material Acknowledgements The authors ... authors would like to thank Nisse Larson for excellent engineering assistance, Maria Frykman for valuable assistance during data collection and Margaretha Marklund for gra...

Ngày tải lên: 19/06/2014, 08:20

... features somewhat unnatural control methods (hand, foot, and tongue motor imagery), as well as variable accuracy and high computational demand. Thus, self-pacing is not the only obstacle to naturalistic ... band power on C3 for the referenced signal. To determine the optimum spatial location and frequency band for discrimination, we conducted a feature analysis by calculating Bhat...

Ngày tải lên: 19/06/2014, 08:20

... evaluation metrics are able to closely approximate human evaluations for various applications. Given an application app and an evaluation guideline package eval, the faithfulness/compactness ... separately evaluated. Each version was evaluated by a human evaluator, with no reference answer available. For this evaluation 115 test questions were used, and the human evaluator w...

Ngày tải lên: 20/02/2014, 16:20

... Computational Linguistics A Support Platform for Event Detection using Social Intelligence Timothy Baldwin, Paul Cook, Bo Han, Aaron Harwood, Shanika Karunasekera and Masud Moshtaghi Department ... lexical normalisation, and geolocation modules, and fi- nally stored in a flat file, which the GUI interacts with. 3.2 Language Filtering For language identification, we use langid.py,...

Ngày tải lên: 08/03/2014, 21:20

... control placenta, whole human skin, normal epidermal and immor- talized keratinocytes, dermal fibroblasts, squamous cell carcinoma and five human melanomas. Thus, these data clarify in detail the cutaneous ... ATTAAGGAGCTTCGGGAGATG Exon 7 380 P558 CTCTTATACCCAATGCTGCTG Exon 10 CYP1 1A First pair P561 GCCTTTGAGTCCATCACTAAC Exon 4 628 P562 CCAGTGTCTTGGCAGGAATC Exon 8 Nested pair P563 ATGTGGC...

Ngày tải lên: 23/03/2014, 13:20

... University 6-6-05, Aramaki Aza Aoba, Aoba-ku, Sendai 980-8579, Japan yotaro-w@ecei.tohoku.ac.jp Masayuki Asahara Yuji Matsumoto Graduate School of Information Science Nara Institute of Science and Technology 8916-5 ... Richard Johans- son, Daisuke Kawahara, Maria Ant ` onia Mart ´ ı, Llu ´ ıs M ` arquez, Adam Meyers, Joakim Nivre, Sebastian Pad ´ o, Jan ˇ St ˇ ep ´ anek, Pavel Stra ˇ n ´ ak...

Ngày tải lên: 30/03/2014, 21:20