Tài liệu Báo cáo khoa học: Role of transcription factor activator protein 1 (AP1) in epidermal growth factor-mediated protection against apoptosis induced by a DNA-damaging agent doc

... Scat- ter factor protects epithelial and carcinoma cells against apoptosis induced by DNA-damaging agents. Oncogene 17 , 13 1 14 1. 15 Geier A, Beery R, Haimsohn M, Hemi R, Malik Z & Karasik A ... & Fan Z (2000) Involvement of p21Waf1 in mediating inhibition of paclitaxel -induced apoptosis by epidermal growth factor in MDA-MB-468 human breast canc...

Ngày tải lên: 19/02/2014, 06:20

... CLP CYP 1A1 β-actin β-actin β-actin β-actin CYP2B1 CYP2E1 CYP 1A2 Fig. 4. Effects of KCs on hepatic CYP 1A1 , 1A2 , 2B1 and 2E1 mRNA expression levels 24 h after CLP. Rats were pretreated intravenously with ... study, CYP 1A1 and 1A2 activities were significantly decreased, with a concomitant decrease in their protein levels during the late phase of sepsis. However, CYP 1A1 and 1A2...

Ngày tải lên: 14/02/2014, 18:20

... (2005) Activation of beta-catenin by carcinogenic Helicobacter pylori. Proc Natl Acad Sci USA 10 2, 10 646 10 6 51. 19 Ohnishi N, Yuasa H, Tanaka S, Sawa H, Miura M, Matsui A, Higashi H, Musashi M, Iwabuchi ... These data suggest the presence of distinct EPIYA-independent domains within CagA that play essential roles in protein targeting and alteration of host-cell transcript...

Ngày tải lên: 14/02/2014, 19:20

... forward 5¢-GTAGGCATGAGAACGGGA AG-3 and for reverse 5¢-GGGGGTAAGAGGAGGAGA AA-3¢ and for CERK-negative forward 5¢-CCGCAAG AGGCTTTATTGTC-3 and reverse 5¢-TATGCCAAGGA CACGGAGAT-3¢, as a negative control ... Westrick RJ & Ginsburg D (19 98) Comparative mapping of distal murine chro- mosome 11 and human 17 q 21. 3 in a region containing a modifying locus for murine plasma von Willeb...

Ngày tải lên: 18/02/2014, 18:20

... 7, 12 25 12 33. 25 Svoboda P & Milligan G (19 94) Agonist -induced trans- fer of the A rtbtmiss of the guanine-nucleotide-binding regulatory proteins Gq and G 11 and of muscarinic m1 acetylcholine ... causative agent of the diarr- heal disease cholera, and mediates its effects by increasing cAMP levels [1] . The resulting increase in intracellular cAMP causes net intest...

Ngày tải lên: 19/02/2014, 02:20

... on analysis of the heat capacity decrement as this parameter is a sensitive indicator of both the changes in hydration and the conformational changes involved in protein ligand interactions [16 ,17 ], ... 5¢-GATATG CAGGTC AACAGGAACCGCGCCAATGGCGCA ACC-3¢. The template used for amplification was the pKK233-2 plasmid containing Enterobacter cloacae MurA wild-type (for generation of t...

Ngày tải lên: 19/02/2014, 13:20

... ideal bond angles (°) 1. 8 % of cases in the most favored regions of Ramachandran plot 92.4 % of cases in disallowed regions of Ramachandran plot 0 average B for main chain atoms (A ˚ 2 ) 30 .1 average ... with OE inhibitor. 0 20 40 60 80 0 20 40 60 80 211 11 314 1 516 1 718 1 91 Residue number chain A chain B B factor B factor Fig. 3. The complex of HIV -1 protease...

Ngày tải lên: 19/02/2014, 16:20

... that a truncated mutant containing five amino acids of the extracellular domain and devoid of any tag was not functional [27], while a mutant containing four amino acids of the ectodomain and including ... Huang, J. & Puett, D. (19 99) Char- acterization of a region of the lutropin receptor extracellular domain near transmembrane helix 1 that is important in ligand- med...

Ngày tải lên: 21/02/2014, 00:20

... monoclonal Z2 antibody in the presence of increasing concentrations of potassium thiocyanate (ranging from 0 to 2.0 m). After incubation and washing, the antibody binding was mea- sured using a goat ... [34]. Statistical analysis Statistical analyses were performed using graphpad prism, version 4.00 (GraphPad Software, San Diego, CA, USA). Statistical analyses of the ELISA data and...

Ngày tải lên: 16/02/2014, 15:20

... potato beetle Leptinotarsa decemlineata. Pest Manag Sci 57, 858–865. 36 Nakagawa Y, Minakuchi C, Takahashi K & Ueno T (2002) Inhibition of [3H] ponasterone A binding by ecdysone agonists in ... available: Fig. S1. Amino acid alignment of linker region and ligand-binding domain (LBD) of ecdysone receptors. Fig. S2. Amino acid alignment of linker region and ligand-binding doma...

Ngày tải lên: 18/02/2014, 08:20